[Genome] Hg18 and NCBI 36.1

[Pauline Fujita]

Hello Anh,

Hg18 is indeed NCBI 36.1. You can check the release name of an assembly 
for a given ucsc assembly name here:

http://genome.ucsc.edu/FAQ/FAQreleases#release1

It looks as though the Agilent coordinates match our coordinates on hg17 
so you may want to contact Agilent regarding the build they used.

Hopefully this information was helpful and answers your question. If you 
have further questions or require clarification feel free to contact the 
mailing list at genome at soe.ucsc.edu.

Regards,

Pauline Fujita
UCSC Genome Bioinformatics Group
http://genome.ucsc.edu

Anh Tran wrote:
> Dear list,
>
> Are these two build the same: Hg18 and NCBI 36.1? We purchased 244k Human
> CpG microarrays from Agilent around the beginning 2007 and they claim to
> base the sequencing on NCBI 36 (do they even exist).
>
> I've run a small check to match the chromosome locations against their
> provided DNA sequences and there are a lot of mismatchs.
>
> Here are a few of them, please advise.
>
> Agilent Chromosome Location:
> chrY:000258483-000258527
> Sequence:
> TTGTCTACATCCGTCACTGGATTTTCTACCCACGGGGACATGTGA
> Hg18 match:
> chrY:208483-208527
>
> Agilent Chromosome Location:
> chr1:176293298-176293357
> Sequence:
> CTGGAGTCTCAGTTATTTGTATCCCACTATTGGTTTTTTTTTAAATCTTTTTTCGTGGGT
> Hg18 match:
> chr1:177828264-177828323
>
> Thank you all.
>
>