[Genome] genome alignment

Kayla Smith kayla at soe.ucsc.edu
Thu Mar 6 17:36:41 PST 2008


Hello again, Vesselin,

What method did you use to obtain the data you have listed below?  Did 
you use Galaxy to get those results?

What you can do with the Genome Browser is to go to the Table Browser 
("Tables" on the blue bar on the top of the main page) and set the 
following options:

clade: Vertebrate; genome: Human; assembly: Mar. 2006;
group: Comparative Genomics; track: Conservation; table: multiz28way
region: (put in the region you are interested in); output format: MAF
and click "Get output".

You can also make an intersection in the Table Browser between a Custom 
Track of the coordinates you are interested in, and the multiz28way table.

Further instructions on the Table Brower can be found here:
http://genome.ucsc.edu/goldenPath/help/hgTablesHelp.html

If you want to get results exactly as you have listed below, you will 
have to use Galaxy.

Kayla Smith
UCSC Genome Bioinformatics Group

Vesselin Baev wrote:
> Dear Kayla Smith,
> I explored the "Tables" menu in Genome browser. I wander what should I
> use to extract regions (with coordinates from RefSeqs) of aligned
> human-chimp genome to look something like this format:
> 
> 
>> NM_017821.0.1	hg17.chr1 206501580 206501621 - 245522847 mm5.chr4
> 122200029 122200071 + 154141344 rn3.chr5 143135020 143135060 +
> 173106704 canFam1.chr15 6850518 6850559 + 67237905
> CCTGCCCCTATTGTAAGTCAATTAATA-AAAAGAGCCATCTGG
> CTTGCCTCTATGATAAACCAGTTAATATAAAAGTGTCACATGG
> CTTGCCTCTGTTATAAGCCACTTAATA--AAAGTGTCACATGG
> CCTGCCTCTCATAGGAAGCAAGTAATG-AAAAGAGCCATCTGG
> 
>> NM_004070.0.0	hg17.chr1 16105460 16105489 + 245522847 mm5.chr4
> 14280459 14280491 - 154141344 rn3.chr5 12802003 12802032 - 173106704
> canFam1.chr2 5413700 5413729 - 87725193
> GCCGGCCCAGCAAGATGAAACAG---GGCACCC
> GTCAGCCTGGGGGGGGTCGGCAGCCTGGCACCC
> GTCAGCCTGG---GAGTCGGCAGCCTGGCGCCC
> GCCAGCCCAGCAAGATGAAACAG---GGTGGCC
> 
>> NM_004070.0.1	hg17.chr1 16105490 16105510 + 245522847 mm5.chr4
> 14280499 14280519 - 154141344 rn3.chr5 12821881 12821900 - 173106704
> canFam1.chr2 5413730 5413751 - 87725193
> CAGCTGACCTGGTACTGAGGT-
> CAGCTGCCATGGATCTGGGAT-
> CAGCTAAGA-GCTGCAGAGGC-
> CGGCCGCCCTGGTGAAGGAGAT
> 
> Vesko
> 
> 
> 
> 
> 2008/3/6, Kayla Smith <kayla at soe.ucsc.edu>:
>>  Hello Vesko,
>>
>>  Yes, we have chain and net data between human and chimp on our website.
>>   To see the chimp chains and nets on human, open the hg18 browser, and
>>  scroll down to the "Comparative Genomics" section.  You'll see "Chimp
>>  Chain" and "Chimp Net" which you can turn on.  You can use our Table
>>  Browser ("Tables" on the blue bar on the top of the main page) to
>>  extract a subset of this data.  And finally, to download this data in
>>  it's entirety, click on "Downloads" --> "Human" --> "Human/Chimp
>>  pairwise alignments" or click here:
>>
>>  http://hgdownload.cse.ucsc.edu/goldenPath/hg18/vsPanTro2/
>>
>>  I hope this information is helpful to you.  Please don't hesitate to
>>  contact us again if you require further assistance.
>>
>>
>>  Kayla Smith
>>  UCSC Genome Bioinformatics Group
>>
>>
>>
>>
>>  Vesselin Baev wrote:
>>  > Dear All,
>>  > Is there an already done genome-wide human-chimp alignment that I can
>>  > use for extracting portions of it with specified coordinates?
>>  > If not, what should I use to make such alignment and what to use to
>>  > extract regions of it with coordinates (Galaxy or?)?
>>  >
>>  > Vesko
>>  >
>>  >
>>
>>
> 
> 



More information about the Genome mailing list