[Genome] genome-wide align

[Vesselin Baev]

Dear all,
 I explored the "Tables" menu in Genome browser. I wander what should I
 use to extract regions (with coordinates from RefSeqs) of aligned
 human-chimp genome to look something like this format:


 >NM_017821.0.1  hg17.chr1 206501580 206501621 - 245522847 mm5.chr4
 122200029 122200071 + 154141344 rn3.chr5 143135020 143135060 +
 173106704 canFam1.chr15 6850518 6850559 + 67237905
 CCTGCCCCTATTGTAAGTCAATTAATA-AAAAGAGCCATCTGG
 CTTGCCTCTATGATAAACCAGTTAATATAAAAGTGTCACATGG
 CTTGCCTCTGTTATAAGCCACTTAATA--AAAGTGTCACATGG
 CCTGCCTCTCATAGGAAGCAAGTAATG-AAAAGAGCCATCTGG

 >NM_004070.0.0  hg17.chr1 16105460 16105489 + 245522847 mm5.chr4
 14280459 14280491 - 154141344 rn3.chr5 12802003 12802032 - 173106704
 canFam1.chr2 5413700 5413729 - 87725193
 GCCGGCCCAGCAAGATGAAACAG---GGCACCC
 GTCAGCCTGGGGGGGGTCGGCAGCCTGGCACCC
 GTCAGCCTGG---GAGTCGGCAGCCTGGCGCCC
 GCCAGCCCAGCAAGATGAAACAG---GGTGGCC

 >NM_004070.0.1  hg17.chr1 16105490 16105510 + 245522847 mm5.chr4
 14280499 14280519 - 154141344 rn3.chr5 12821881 12821900 - 173106704
 canFam1.chr2 5413730 5413751 - 87725193
 CAGCTGACCTGGTACTGAGGT-
 CAGCTGCCATGGATCTGGGAT-
 CAGCTAAGA-GCTGCAGAGGC-
 CGGCCGCCCTGGTGAAGGAGAT

 Vesko




 2008/3/6, Kayla Smith <kayla at soe.ucsc.edu>:

>
 >  Hello Vesko,
 >
 >  Yes, we have chain and net data between human and chimp on our website.
 >   To see the chimp chains and nets on human, open the hg18 browser, and
 >  scroll down to the "Comparative Genomics" section.  You'll see "Chimp
 >  Chain" and "Chimp Net" which you can turn on.  You can use our Table
 >  Browser ("Tables" on the blue bar on the top of the main page) to
 >  extract a subset of this data.  And finally, to download this data in
 >  it's entirety, click on "Downloads" --> "Human" --> "Human/Chimp
 >  pairwise alignments" or click here:
 >
 >  http://hgdownload.cse.ucsc.edu/goldenPath/hg18/vsPanTro2/
 >
 >  I hope this information is helpful to you.  Please don't hesitate to
 >  contact us again if you require further assistance.
 >
 >
 >  Kayla Smith
 >  UCSC Genome Bioinformatics Group
 >
 >
 >
 >
 >  Vesselin Baev wrote:
 >  > Dear All,
 >  > Is there an already done genome-wide human-chimp alignment that I can
 >  > use for extracting portions of it with specified coordinates?
 >  > If not, what should I use to make such alignment and what to use to
 >  > extract regions of it with coordinates (Galaxy or?)?
 >  >
 >  > Vesko
 >  >
 >  >
 >
 >



--

 ------------------------------------------------
 Vesselin Baev, PhD
 University of Plovdiv
 Dept. Molecular Biology
 Bioinformatics Group
 Tzar Assen 24
 Plovdiv 4000, BULGARIA
 032/ 261 (534)
 089/ 43 80 945
 Skype: vesselin_baev
 vebaev at gmail.com
 baev at uni-plovdiv.bg


-- 

------------------------------------------------
Vesselin Baev, PhD
University of Plovdiv
Dept. Molecular Biology
Bioinformatics Group
Tzar Assen 24
Plovdiv 4000, BULGARIA
032/ 261 (534)
089/ 43 80 945
Skype: vesselin_baev
vebaev at gmail.com
baev at uni-plovdiv.bg