[Genome] aligning short sequences with BLAT

[Robert Hunter]

Hello.  I'm having difficulty with using standalone BLAT ( version 3.4
) to align short DNA sequences.  My targets are 30-mers and the
queries are 11-mers.  Matches should be anything over 80% identity.  I
followed the guidelines listed at the BLAT FAQ, for "Using Blat for
short sequences with maximum sensitivity," however I am still unable
to produce matches, even with exact queries.

E.g,

I have database.fa with a single entry:

>TEST1|offset|123|
TACTGGATTCCGAGACCACACGCGTCGTAG


...and a query.fa with a single entry:

>TEST2|offset|456|
CCGAGACCACA


Using the following command, I expect that I should get a match in
output.psl, however BLAT returns no results (an empty output file).

blat -t=dna -q=dna -fine -tileSize=6 -stepSize=3 -minMatch=1
-repMatch=1000000 -noHead -out=psl database.fa query.fa output.psl

According to the FAQ, a guarantied match should occur when the query size is:
 2 * stepSize + tileSize - 1

Am I doing something wrong?  Any suggestions would be greatly appreciated.

-- 
RH