[Genome] BLAT miRNA
Gao, Ge
gaog at mail.cbi.pku.edu.cn
Thu Jan 3 03:55:36 PST 2008
Thanks, it works now!
But just another question: if so, what's the real difference between "-q=rna"
and "-q=dna"?
Thanks for your kindly help again!:)
Gao, Ge
----- Original Message -----
From: "Galt Barber" <galt at soe.ucsc.edu>
To: "Gao, Ge" <gaog at mail.cbi.pku.edu.cn>
Cc: <genome at soe.ucsc.edu>
Sent: Thursday, January 03, 2008 5:20 AM
Subject: Re: [Genome] BLAT miRNA
>
> Please try your stand-alone blat query using
> "T" instead of "U". BLAT does not currently
> understand the symbol "U", and treats it as
> if it were an "N". For DNA/RNA, BLAT just
> uses these symbols for queries: {A,C,G,T,N}
>
> hgBlat does a little extra pre-processing
> to translate U to T before calling gfServer,
> but this does not happen in standalone blat.
>
> You'll notice that even in the hgBlat output
> detailed alignment, the aligment is reported
> with T's, not U's.
>
> I'm afraid "U" just doesn't get its due!
>
> Thank you!
>
> -Galt
>
>
> On Sun, 23 Dec 2007, Gao, Ge wrote:
>
>> Hi,
>>
>> I'm trying to align a miRNA (dme-mir-100) stem-loop sequence againest dm2
>> genome by local standalone BLAT.
>>
>> >dme-mir-100 MI0000378
>> CCAUUAACAGAAACCCGUAAAUCCGAACUUGUGCUGUUUUAUAUCUGUUACAAGACCGGCAUUAUGGGAGUCUGUCAAUGCAAACAACUGGUUUUUGGCA
>>
>> When running the query on Webblat, I found the exact match:
>> chr2L:18467363~18467462(+).
>>
>> However, when I do it on the local standalone BLAT with default settings,
>> no
>> result was found.
>>
>> After some surfing, I followed the suggestions from
>> http://www.soe.ucsc.edu/pipermail/genome/2006-October/011872.html, and
>> changed
>> the command line to:
>>
>> blat dm2_genome.fn query.fn
>> output.psl -t=dna -q=rna -stepSize=2 -tileSize=6 -minScore=0 -minIdentity=100
>>
>> This brought up 134 hits (11 on chr2L), but no the right one. :(
>>
>> Could you give me some clues? and are there recommended settings to run
>> BLAT
>> on miRNA?
>>
>> Thanks,
>> Gao
>>
>> _______________________________________________
>> Genome maillist - Genome at soe.ucsc.edu
>> http://www.soe.ucsc.edu/mailman/listinfo/genome
>>
More information about the Genome
mailing list