From ann at soe.ucsc.edu  Wed Jan  2 09:23:48 2008
From: ann at soe.ucsc.edu (Ann Zweig)
Date: Wed, 02 Jan 2008 09:23:48 -0800
Subject: [Genome] [Fwd: A query on the Genome Browser]
In-Reply-To: <477BC36F.2050601@ucsc.edu>
References: <477BC36F.2050601@ucsc.edu>
Message-ID: <477BC8A4.2050704@soe.ucsc.edu>

Hello Siddarth,

	In the genome browser and the associated tools, much of the upper- and 
lower-case display is controlled by the user.  When you ask for DNA sequence 
output using most tools (Table Browser, 'DNA' link, etc.) the case is 
configurable.  So this inconsistency may be a simple factor of your having two 
views configured differently.

	When you retrieved the output from the Table Browser, you must have chosen a 
gene set from which to extract the exonic sequence (e.g. RefSeq Genes, UCSC 
Genes, etc.).  I note that in the particular location you mention 
(chrM:6903-7445) there is a UCSC Gene, but not a RefSeq Gene.  This could be 
causing the inconsistency you are seeing.

	In the future, please direct your questions to the genome mailing list at 
genome at soe.ucsc.edu -- our moderated forum for user questions and discussion. 
You will likely get a quicker response to your question.

	I hope this information is helpful to you.  If this has not fully addressed 
your issue, please contact the list again with further details and a list of the 
exact steps you have taken to see the inconsistency.

Regards,

----------
Ann Zweig
UCSC Genome Bioinformatics Group
http://genome.ucsc.edu

Please feel free to search the Genome mailing list archives by visiting our home 
page, clicking on "Contact Us", then typing a word or phrase into the search 
box.  On that same page
(http://genome.ucsc.edu/contacts.html), you can subscribe to the Genome mailing 
list.




> -------- Original Message --------
> Subject: 	A query on the Genome Browser
> Date: 	Mon, 31 Dec 2007 16:44:27 -0700
> From: 	SiddarthGautham Selvaraj <sselvar1 at asu.edu>
> To: 	cbseweb at cbse.ucsc.edu
> 
> 
> 
> Respected Sir:
> 
> I am Siddarth Gautham Selvaraj, a graduate student in Arizona State 
> University. My interest lies in collecting all the coding exons in the 
> human genome with its homologs.
> 
> I used Table browser to get the sequences of all codig exons for each 
> chromosome. An interesting fact which I found out and could not 
> understand is that why not all coding exons mentioned by the Table 
> Browser not capitalized n the genome browser window. I find for example 
> in chromosome M sequence in position 6903-7445 as coding exons in Table 
> Browser but the same sequence is not capitalized which means is not 
> considered coding by the genome browser. I found very difficult to 
> understand this concept.
> 
> Also what exactly is the capitalized coding regions put by the genome 
> browser?
> 
> Thanks
> siddarth


From rhead at soe.ucsc.edu  Wed Jan  2 13:10:50 2008
From: rhead at soe.ucsc.edu (Brooke Rhead)
Date: Wed, 02 Jan 2008 13:10:50 -0800
Subject: [Genome] BAC track
In-Reply-To: <BAY121-DAV8117799B05BDDC3B0FE4DC3510@phx.gbl>
References: <BAY121-DAV8117799B05BDDC3B0FE4DC3510@phx.gbl>
Message-ID: <477BFDDA.4060903@soe.ucsc.edu>

Hello Shlomit,

Each BAC end pair consists of a + strand read from one end of the BAC 
and a - strand read from the other end of the BAC.  You should see one + 
and one - alignment if you click on the details page for any BAC end pair.

Each BAC pair can be oriented in either direction when compared to the 
genomic sequence, indicated in the "strand" field.  See an explanation 
in this previously-answered question:

http://www.soe.ucsc.edu/pipermail/genome/2006-July/011146.html

I hope this answers your question.

--
Brooke Rhead
UCSC Genome Bioinformatics Group


Shlomit wrote:
> Hello,
> 
>  
> 
> First, thanks for the very useful site and your support. 
> 
>  
> 
> I was looking at your BAC track in the mouse genome, I couldn't understand
> what is the "strand" (+ or -) field means. the BAC DNA is double-stranded,
> isn't it?
> 
>  
> 
> Thank a lot,
> 
> Shlomit Amar-Farkash
> 
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome

From galt at soe.ucsc.edu  Wed Jan  2 13:20:41 2008
From: galt at soe.ucsc.edu (Galt Barber)
Date: Wed, 2 Jan 2008 13:20:41 -0800 (PST)
Subject: [Genome] BLAT miRNA
In-Reply-To: <07ce01c8455b$800bb310$d4fa69a2@msworkstation>
References: <07ce01c8455b$800bb310$d4fa69a2@msworkstation>
Message-ID: <Pine.GSO.4.58.0801021311210.28251@sundance.cse.ucsc.edu>


Please try your stand-alone blat query using
"T" instead of "U".  BLAT does not currently
understand the symbol "U", and treats it as
if it were an "N".    For DNA/RNA, BLAT just
uses these symbols for queries: {A,C,G,T,N}

hgBlat does a little extra pre-processing
to translate U to T before calling gfServer,
but this does not happen in standalone blat.

You'll notice that even in the hgBlat output
detailed alignment, the aligment is reported
with T's, not U's.

I'm afraid "U" just doesn't get its due!

Thank you!

-Galt


On Sun, 23 Dec 2007, Gao, Ge wrote:

> Hi,
>
> I'm trying to align a miRNA (dme-mir-100) stem-loop sequence againest dm2
> genome by local standalone BLAT.
>
> >dme-mir-100 MI0000378
> CCAUUAACAGAAACCCGUAAAUCCGAACUUGUGCUGUUUUAUAUCUGUUACAAGACCGGCAUUAUGGGAGUCUGUCAAUGCAAACAACUGGUUUUUGGCA
>
> When running the query on Webblat, I found the exact match:
> chr2L:18467363~18467462(+).
>
> However, when I do it on the local standalone BLAT with default settings, no
> result was found.
>
> After some surfing, I followed the suggestions from
> http://www.soe.ucsc.edu/pipermail/genome/2006-October/011872.html, and changed
> the command line to:
>
> blat dm2_genome.fn query.fn
> output.psl -t=dna -q=rna -stepSize=2 -tileSize=6 -minScore=0 -minIdentity=100
>
> This brought up 134 hits (11 on chr2L), but no the right one. :(
>
> Could you give me some clues? and are there recommended settings to run BLAT
> on miRNA?
>
> Thanks,
> Gao
>
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome
>

From rhead at soe.ucsc.edu  Wed Jan  2 14:56:42 2008
From: rhead at soe.ucsc.edu (Brooke Rhead)
Date: Wed, 02 Jan 2008 14:56:42 -0800
Subject: [Genome] the kgAlias table
In-Reply-To: <ee5d33dd0712310748m3117fb98hb2f90938fc357b21@mail.gmail.com>
References: <ee5d33dd0712310748m3117fb98hb2f90938fc357b21@mail.gmail.com>
Message-ID: <477C16AA.40807@soe.ucsc.edu>

Hello Yuval,

Not every gene in GenBank is part of the "UCSC Genes" set, so there will 
not be a corresponding UCSC Gene name for every one.  The process used 
to create the gene set is displayed when you click on the track name in 
the Genome Browser (the blue link above the drop-down box that lets you 
hide or show the track), or by clicking on the blue or grey 
"mini-button" to the far left of the track in the main display.

Note that he three gene names that have matches in the Genome Browser 
when using the search/position box (FAM21B, TMEM23, LIPL2) are not 
matches to the UCSC Genes track, but to the "RefSeq Genes" and 
"Non-Human RefSeq Genes" tracks (assuming you are using the hg18 assembly).

I hope this helps explain what you are seeing.  If you have further 
questions, please feel free to contact us again at the mailing list address.

--
Brooke Rhead
UCSC Genome Bioinformatics Group



Yuval Nevo wrote:
> hi,
> I have a list of genes taken from the GenBank files (last version, 29 Aug.
> 2006) that I am trying to match with the unique UCSC gene names (e.g.
> uc001aaa.1), using the kgAlias table.
> I have encountered numerous gene names with no match. 1960 names start with
> 'LOC', another 408 do not. below are several examples:
> LOC642622
> LOC728065
> LOC728152
> (when searched for in the genome browser they can't be found)
> and
> FAM21B
> TMEM23
> LIPL2
> (are found in the browser but have a different name in the kgAlias table).
> Why can't I find these aliases in the kgAlias table? Should the table be
> updated?
> note: I can send the full list of these names if you like.
> Thanks, Yuval (a PhD student).
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome

From ann at soe.ucsc.edu  Wed Jan  2 15:37:41 2008
From: ann at soe.ucsc.edu (Ann Zweig)
Date: Wed, 02 Jan 2008 15:37:41 -0800
Subject: [Genome] (no subject)
In-Reply-To: <d65.1af6b51d.34ad286f@aol.com>
References: <d65.1af6b51d.34ad286f@aol.com>
Message-ID: <477C2045.50108@soe.ucsc.edu>

Hello Kurt,

	Thanks for pointing this out and sorry for the inconvenience.  The software on 
that blat/pcr server needs to be updated.  Hopefully this will happen later 
today or tomorrow.


Regards,

----------
Ann Zweig
UCSC Genome Bioinformatics Group
http://genome.ucsc.edu



Kurt311311 at aol.com wrote:
>  
> http://genome.ucsc.edu/cgi-bin/hgPcr?hgsid=101894276&org=Lizard&db=anoCar1&wp_f=atacagtgttccctcactta&wp_r=atacagtgttccctcactta&Submit=submit&wp_size=5000&wp_perfect=15&wp_good=15&wp_flipReverse=on&boolshad.wp_flipReverse=1 
> <http://genome.ucsc.edu/cgi-bin/hgPcr?hgsid=101894276&org=Lizard&db=anoCar1&wp_f=atacagtgttccctcactta&wp_r=atacagtgttccctcactta&Submit=submit&wp_size=5000&wp_perfect=15&wp_good=15&wp_flipReverse=on&boolshad.wp_flipReverse=1>
>  
>  
> help!!!  It's been doing this for days!!!!
>  
>  
>  
> 
> 
> 
> ------------------------------------------------------------------------
> See AOL's top rated recipes 
> <http://food.aol.com/top-rated-recipes?NCID=aoltop00030000000004> and 
> easy ways to stay in shape 
> <http://body.aol.com/fitness/winter-exercise?NCID=aoltop00030000000003> 
> for winter.

From sgao at mcw.edu  Thu Jan  3 06:34:40 2008
From: sgao at mcw.edu (Gao, Shouguo)
Date: Thu, 3 Jan 2008 08:34:40 -0600
Subject: [Genome] How to get snps locate between the start and end
	chromosomal location of each gene with Entrez GeneID
Message-ID: <EEE1E47094AB7C4DA2868E679EA488F80AE8D928@MCWMAIL.mcwcorp.net>

It is really useful to connect to mySQL server. Now I have a large snp list, and I am looking for the snps related to a gene list (Entrez Geneid), which locate between 1000 upstream and 500 downstream of genes. The most important thing is to find the start and end chromosomal location of each gene with Entrez GeneID. I used knowngene and knownToLocusLink tables, but got several locations for one Entrez GeneID (Locuslink). 

 

name    locuslink           chro     strand   start      end

uc001aab.1      375690            chr1     -           4558    14764

uc001aac.1      375690            chr1     -           4558    19346

uc001aad.1      375690            chr1     -           4558    7231

uc001aae.1      375690            chr1     -           4558    9622

uc001aaf.1       375690            chr1     -           4832    19672

uc001aag.1      375690            chr1     -           5658    7231

uc001aah.1      375690            chr1     -           6720    19346

uc001aai.1       375690            chr1     -           6720    9622

 

The reason should be that the same Entrez Gene ID matches multiple UCSC known genes (transcript).

 

In NCBI one Entrez GeneID only has one start and end location. Could you please tell me how to solve this issue? Is there any other table for that?

 

Thanks

 

Shouguo



From sde at mrc-lmb.cam.ac.uk  Thu Jan  3 09:42:31 2008
From: sde at mrc-lmb.cam.ac.uk (Subhajyoti De)
Date: Thu, 03 Jan 2008 17:42:31 +0000
Subject: [Genome] Gene Order in primates
In-Reply-To: <010201c84416$c459d510$0ba8a8c0@donnakLT>
References: <C3911406.116AA%bobs@ncifcrf.gov>
	<010201c84416$c459d510$0ba8a8c0@donnakLT>
Message-ID: <477D1E87.60106@mrc-lmb.cam.ac.uk>

Hi,

   Greetings of new year. I have a naive question to ask about genome 
assembly and gene order in chimpanzee and macaque.

     I have a list of a few human genes, whose orthologs (or homologs) 
in chimpanzee and macaque are located at different chromosomal 
locations, while orthologs of most of the neighboring genes still 
maintain synteny. For example, a gene is located in human chromosome 12. 
It has one ortholog in chimpanzee and that is located in chimp 
chromosome 18 (and no paralog or pseudogene is present at position 
equivalent to that in human chromosome 12). Many such cases are 
biologically known, driven by short rearrangements or retrotransposon 
mediated activities, while a small number of others can appear due to 
errors in genome assembly.

    Can you kindly give me a rough estimate, how many such cases of 
altered gene order I can expect in the current release of chimpanzee and 
macaque genome due to assembly error and/or coverage?

Many thanks,
Subho

From Bart.Aelterman at ua.ac.be  Thu Jan  3 05:51:44 2008
From: Bart.Aelterman at ua.ac.be (Aelterman Bart)
Date: Thu, 3 Jan 2008 14:51:44 +0100
Subject: [Genome] differences in annotation databases
Message-ID: <50F55D0085412B49B8C9AB7C2A6948D901C1154A@xmail01.ad.ua.ac.be>


Dear,

I want to download the ENCODE Annotation Database to run some tests local. Apparently there are two ways to do this:
       - Download the Annotation Database from http://hgdownload.cse.ucsc.edu/goldenPath/hg18/encode/database/, or
       - Download the Test Annotation Database from http://hgdownload.cse.ucsc.edu/goldenPath/hg18encodedev/database/.
I find this rather confusing and the difference between these two databases is not explained in your documentation nor in the papers describing the ENCODE Annotation data. Could you tell me what the difference is and which one is the preferred reference annotation? I assume this would be the Annotation Database, but the existence of an undefined Test Annotation Database makes it a bit confusing.

Thanks in advance,

Bart Aelterman


From gaog at mail.cbi.pku.edu.cn  Thu Jan  3 03:55:36 2008
From: gaog at mail.cbi.pku.edu.cn (Gao, Ge)
Date: Thu, 3 Jan 2008 19:55:36 +0800
Subject: [Genome] BLAT miRNA
References: <07ce01c8455b$800bb310$d4fa69a2@msworkstation>
	<Pine.GSO.4.58.0801021311210.28251@sundance.cse.ucsc.edu>
Message-ID: <017001c84dff$8de9ad00$d4fa69a2@msworkstation>

Thanks, it works now!

But just another question: if so, what's the real difference between "-q=rna" 
and "-q=dna"?

Thanks for your kindly help again!:)

Gao, Ge

----- Original Message ----- 
From: "Galt Barber" <galt at soe.ucsc.edu>
To: "Gao, Ge" <gaog at mail.cbi.pku.edu.cn>
Cc: <genome at soe.ucsc.edu>
Sent: Thursday, January 03, 2008 5:20 AM
Subject: Re: [Genome] BLAT miRNA


>
> Please try your stand-alone blat query using
> "T" instead of "U".  BLAT does not currently
> understand the symbol "U", and treats it as
> if it were an "N".    For DNA/RNA, BLAT just
> uses these symbols for queries: {A,C,G,T,N}
>
> hgBlat does a little extra pre-processing
> to translate U to T before calling gfServer,
> but this does not happen in standalone blat.
>
> You'll notice that even in the hgBlat output
> detailed alignment, the aligment is reported
> with T's, not U's.
>
> I'm afraid "U" just doesn't get its due!
>
> Thank you!
>
> -Galt
>
>
> On Sun, 23 Dec 2007, Gao, Ge wrote:
>
>> Hi,
>>
>> I'm trying to align a miRNA (dme-mir-100) stem-loop sequence againest dm2
>> genome by local standalone BLAT.
>>
>> >dme-mir-100 MI0000378
>> CCAUUAACAGAAACCCGUAAAUCCGAACUUGUGCUGUUUUAUAUCUGUUACAAGACCGGCAUUAUGGGAGUCUGUCAAUGCAAACAACUGGUUUUUGGCA
>>
>> When running the query on Webblat, I found the exact match:
>> chr2L:18467363~18467462(+).
>>
>> However, when I do it on the local standalone BLAT with default settings,
>> no
>> result was found.
>>
>> After some surfing, I followed the suggestions from
>> http://www.soe.ucsc.edu/pipermail/genome/2006-October/011872.html, and
>> changed
>> the command line to:
>>
>> blat dm2_genome.fn query.fn
>> output.psl -t=dna -q=rna -stepSize=2 -tileSize=6 -minScore=0 -minIdentity=100
>>
>> This brought up 134 hits (11 on chr2L), but no the right one. :(
>>
>> Could you give me some clues? and are there recommended settings to run
>> BLAT
>> on miRNA?
>>
>> Thanks,
>> Gao
>>
>> _______________________________________________
>> Genome maillist  -  Genome at soe.ucsc.edu
>> http://www.soe.ucsc.edu/mailman/listinfo/genome
>>


From kayla at soe.ucsc.edu  Thu Jan  3 12:09:27 2008
From: kayla at soe.ucsc.edu (Kayla Smith)
Date: Thu, 03 Jan 2008 12:09:27 -0800
Subject: [Genome] BLAT miRNA
In-Reply-To: <017001c84dff$8de9ad00$d4fa69a2@msworkstation>
References: <07ce01c8455b$800bb310$d4fa69a2@msworkstation>	<Pine.GSO.4.58.0801021311210.28251@sundance.cse.ucsc.edu>
	<017001c84dff$8de9ad00$d4fa69a2@msworkstation>
Message-ID: <477D40F7.901@cse.ucsc.edu>

Hello Gao,Ge,

You can find the answer to your question in this previously answered 
mailing list question.

http://www.soe.ucsc.edu/pipermail/genome/2006-August/011440.html

Kayla Smith
UCSC Genome Bioinformatics Group


Gao, Ge wrote:
> Thanks, it works now!
> 
> But just another question: if so, what's the real difference between "-q=rna" 
> and "-q=dna"?
> 
> Thanks for your kindly help again!:)
> 
> Gao, Ge
> 
> ----- Original Message ----- 
> From: "Galt Barber" <galt at soe.ucsc.edu>
> To: "Gao, Ge" <gaog at mail.cbi.pku.edu.cn>
> Cc: <genome at soe.ucsc.edu>
> Sent: Thursday, January 03, 2008 5:20 AM
> Subject: Re: [Genome] BLAT miRNA
> 
> 
>> Please try your stand-alone blat query using
>> "T" instead of "U".  BLAT does not currently
>> understand the symbol "U", and treats it as
>> if it were an "N".    For DNA/RNA, BLAT just
>> uses these symbols for queries: {A,C,G,T,N}
>>
>> hgBlat does a little extra pre-processing
>> to translate U to T before calling gfServer,
>> but this does not happen in standalone blat.
>>
>> You'll notice that even in the hgBlat output
>> detailed alignment, the aligment is reported
>> with T's, not U's.
>>
>> I'm afraid "U" just doesn't get its due!
>>
>> Thank you!
>>
>> -Galt
>>
>>
>> On Sun, 23 Dec 2007, Gao, Ge wrote:
>>
>>> Hi,
>>>
>>> I'm trying to align a miRNA (dme-mir-100) stem-loop sequence againest dm2
>>> genome by local standalone BLAT.
>>>
>>>> dme-mir-100 MI0000378
>>> CCAUUAACAGAAACCCGUAAAUCCGAACUUGUGCUGUUUUAUAUCUGUUACAAGACCGGCAUUAUGGGAGUCUGUCAAUGCAAACAACUGGUUUUUGGCA
>>>
>>> When running the query on Webblat, I found the exact match:
>>> chr2L:18467363~18467462(+).
>>>
>>> However, when I do it on the local standalone BLAT with default settings,
>>> no
>>> result was found.
>>>
>>> After some surfing, I followed the suggestions from
>>> http://www.soe.ucsc.edu/pipermail/genome/2006-October/011872.html, and
>>> changed
>>> the command line to:
>>>
>>> blat dm2_genome.fn query.fn
>>> output.psl -t=dna -q=rna -stepSize=2 -tileSize=6 -minScore=0 -minIdentity=100
>>>
>>> This brought up 134 hits (11 on chr2L), but no the right one. :(
>>>
>>> Could you give me some clues? and are there recommended settings to run
>>> BLAT
>>> on miRNA?
>>>
>>> Thanks,
>>> Gao
>>>
>>> _______________________________________________
>>> Genome maillist  -  Genome at soe.ucsc.edu
>>> http://www.soe.ucsc.edu/mailman/listinfo/genome
>>>
> 
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome


From rhead at soe.ucsc.edu  Thu Jan  3 12:33:25 2008
From: rhead at soe.ucsc.edu (Brooke Rhead)
Date: Thu, 03 Jan 2008 12:33:25 -0800
Subject: [Genome] How to get snps locate between the start and
 end	chromosomal location of each gene with Entrez GeneID
In-Reply-To: <EEE1E47094AB7C4DA2868E679EA488F80AE8D928@MCWMAIL.mcwcorp.net>
References: <EEE1E47094AB7C4DA2868E679EA488F80AE8D928@MCWMAIL.mcwcorp.net>
Message-ID: <477D4695.1070104@soe.ucsc.edu>

Hello Shouguo,

There are two tables related to UCSC Genes that you can use to get a 
single splice variant for each gene: knownCanonical and knownIsoforms.

The knownIsoforms table contains all of the items in knownGene grouped 
into clusters, and knownCanonical contains a single isoform for each 
cluster, along with its position. (See this previously-answered question 
for how these tables are made: 
http://www.soe.ucsc.edu/pipermail/genome/2005-July/008123.html .)

In your example, the canonical transcript for the locusLink ID 375690 is 
uc001aad.1:

mysql> select * from knownIsoforms where clusterId=2 order by transcript;
+-----------+------------+
| clusterId | transcript |
+-----------+------------+
|         2 | uc001aab.1 |
|         2 | uc001aac.1 |
|         2 | uc001aad.1 |
|         2 | uc001aae.1 |
|         2 | uc001aaf.1 |
|         2 | uc001aag.1 |
|         2 | uc001aah.1 |
|         2 | uc001aai.1 |
+-----------+------------+
8 rows in set (0.01 sec)

mysql> select * from knownCanonical where clusterId=2;
+-------+------------+----------+-----------+------------+------------+
| chrom | chromStart | chromEnd | clusterId | transcript | protein    |
+-------+------------+----------+-----------+------------+------------+
| chr1  |       4558 |     7231 |         2 | uc001aad.1 | uc001aad.1 |
+-------+------------+----------+-----------+------------+------------+
1 row in set (0.01 sec)


I hope this information helps.  Please let us know if you have any 
further questions.

--
Brooke Rhead
UCSC Genome Bioinformatics Group


Gao, Shouguo wrote:
> It is really useful to connect to mySQL server. Now I have a large
> snp list, and I am looking for the snps related to a gene list (Entrez
Geneid), which locate between 1000 upstream and 500 downstream of genes.
The most important thing is to find the start and end chromosomal
location of each gene with Entrez GeneID. I used knowngene and
knownToLocusLink tables, but got several locations for one Entrez GeneID
(Locuslink).
> 
> 
> 
> name locuslink chro strand start end
> 
> uc001aab.1 375690 chr1 - 4558 14764
> 
> uc001aac.1 375690 chr1 - 4558 19346
> 
> uc001aad.1 375690 chr1 - 4558 7231
> 
> uc001aae.1 375690 chr1 - 4558 9622
> 
> uc001aaf.1 375690 chr1 - 4832 19672
> 
> uc001aag.1 375690 chr1 - 5658 7231
> 
> uc001aah.1 375690 chr1 - 6720 19346
> 
> uc001aai.1 375690 chr1 - 6720 9622
> 
> 
> 
> The reason should be that the same Entrez Gene ID matches multiple
UCSC known genes (transcript).
> 
> 
> 
> In NCBI one Entrez GeneID only has one start and end location. Could
you please tell me how to solve this issue? Is there any other table for
that?

>  
> 
> Thanks
> 
>  
> 
> Shouguo
> 
> 
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome

From kayla at soe.ucsc.edu  Thu Jan  3 16:59:27 2008
From: kayla at soe.ucsc.edu (Kayla Smith)
Date: Thu, 03 Jan 2008 16:59:27 -0800
Subject: [Genome] differences in annotation databases
In-Reply-To: <50F55D0085412B49B8C9AB7C2A6948D901C1154A@xmail01.ad.ua.ac.be>
References: <50F55D0085412B49B8C9AB7C2A6948D901C1154A@xmail01.ad.ua.ac.be>
Message-ID: <477D84EF.1030102@cse.ucsc.edu>


Hello Bart,

Coming from the main Encode page: 
http://hgdownload.cse.ucsc.edu/goldenPath/encode/

The first link is the one you want: 
http://hgdownload.cse.ucsc.edu/goldenPath/hg18/encode/database/

The difference between the two links you've mentioned is that the second 
  of them may contain development, or test, data.  That is, work in 
progress.  Such data may not have gone through our rigorous QA process 
and so could have errors.

I hope this information is helpful to you.  Please don't hesitate to 
contact us again if you require further assistance.

Kayla Smith
UCSC Genome Bioinformatics Group


Aelterman Bart wrote:
> Dear,
> 
> I want to download the ENCODE Annotation Database to run some tests local. Apparently there are two ways to do this:
>        - Download the Annotation Database from http://hgdownload.cse.ucsc.edu/goldenPath/hg18/encode/database/, or
>        - Download the Test Annotation Database from http://hgdownload.cse.ucsc.edu/goldenPath/hg18encodedev/database/.
> I find this rather confusing and the difference between these two databases is not explained in your documentation nor in the papers describing the ENCODE Annotation data. Could you tell me what the difference is and which one is the preferred reference annotation? I assume this would be the Annotation Database, but the existence of an undefined Test Annotation Database makes it a bit confusing.
> 
> Thanks in advance,
> 
> Bart Aelterman
> 
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome


From tingchiun at gmail.com  Thu Jan  3 20:56:10 2008
From: tingchiun at gmail.com (Ting-chiun Chung)
Date: Fri, 4 Jan 2008 12:56:10 +0800
Subject: [Genome] promoter location
Message-ID: <c9156f400801032056s2fde6362oc4bc49b092f04377@mail.gmail.com>

Dear Sir:

     I am planning to plot the Gene exons whit perl GD,
     I have implied the refGene table witch contains the exons location for
each refseq ID,
     However, I also need to plot the promoter resion of the related genes,
     Do you have any table witch contain this kind of information?
     Thanks for your help

    Sincerely


            Ting-Chiun

From ann at soe.ucsc.edu  Fri Jan  4 09:47:46 2008
From: ann at soe.ucsc.edu (Ann Zweig)
Date: Fri, 04 Jan 2008 09:47:46 -0800
Subject: [Genome] promoter location
In-Reply-To: <c9156f400801032056s2fde6362oc4bc49b092f04377@mail.gmail.com>
References: <c9156f400801032056s2fde6362oc4bc49b092f04377@mail.gmail.com>
Message-ID: <477E7142.5060903@cse.ucsc.edu>

Hello Ting-Chiun,

	We have several annotation tracks in the browser that show promoters. 
Some are experimentally derived, others are computed bioinformatically. 
You will find all of the tracks in the "Expression and Regulation" group 
of the track controls.

	In the hg18 assembly, there is a 'FirstEF' track which predicts exon, 
promoter and CpG window. There is also a track called the 'TFBS
Conserved' that contains the location and score of transcription factor
binding sites conserved in the human/mouse/rat alignment. The 'Reg
Potential 7 species' track predicts regulatory regions. You can read the
track descriptions and decide for yourself which one best fits your needs.

	I hope this information is helpful to you.  Please don't hesitate to 
contact the mail list again if you require further assistance.

Regards,

----------
Ann Zweig
UCSC Genome Bioinformatics Group
http://genome.ucsc.edu

Please feel free to search the Genome mailing list archives by visiting 
our home page, clicking on "Contact Us", then typing a word or phrase 
into the search box.  On that same page 
(http://genome.ucsc.edu/contacts.html), you can subscribe to the Genome 
mailing list.

Ting-chiun Chung wrote:
> Dear Sir:
> 
>      I am planning to plot the Gene exons whit perl GD,
>      I have implied the refGene table witch contains the exons location for
> each refseq ID,
>      However, I also need to plot the promoter resion of the related genes,
>      Do you have any table witch contain this kind of information?
>      Thanks for your help
> 
>     Sincerely
> 
> 
>             Ting-Chiun
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome

From watersto at u.washington.edu  Fri Jan  4 10:25:19 2008
From: watersto at u.washington.edu (Bob Waterston)
Date: Fri, 4 Jan 2008 11:25:19 -0700
Subject: [Genome] custom tracks
Message-ID: <p06230913c3a42a09543e@[128.208.26.32]>

Dear Folks,

I'm having trouble with custom tracks.  I load tracks (i've used 
these successfully before many times), the window comes back showing 
that the tracks have been loaded, but when I click on go to 'genome 
browser' the tracks don't show up and indeed seem to have disappeared.

Any suggestions?

Thanks,
Bob Waterston

From watersto at u.washington.edu  Fri Jan  4 10:34:11 2008
From: watersto at u.washington.edu (Bob Waterston)
Date: Fri, 4 Jan 2008 11:34:11 -0700
Subject: [Genome] custom tracks
Message-ID: <p06230914c3a42b0a907b@[128.208.26.32]>

Dear Folks,

I'm having trouble with custom tracks.  I load tracks (i've used 
these successfully before many times), the window comes back showing 
that the tracks have been loaded, but when I click on go to 'genome 
browser' the tracks don't show up and indeed seem to have disappeared.

Any suggestions?

Thanks,
Bob Waterston

********************

I just got it to work -- I had opened an old page and had been trying 
to add from that.  When I went back to home and reopened the worm 
genome it seems to have righted itself.

Sorry to have bothered you.

Bob


From hiram at soe.ucsc.edu  Fri Jan  4 14:32:09 2008
From: hiram at soe.ucsc.edu (Hiram Clawson)
Date: Fri, 04 Jan 2008 14:32:09 -0800
Subject: [Genome] custom tracks
In-Reply-To: <p06230913c3a42a09543e@[128.208.26.32]>
References: <p06230913c3a42a09543e@[128.208.26.32]>
Message-ID: <477EB3E9.1070603@soe.ucsc.edu>

I'll check on this Bob.  We are having unusual power outages
today which may cause this.

--Hiram

Bob Waterston wrote:
> Dear Folks,
> 
> I'm having trouble with custom tracks.  I load tracks (i've used 
> these successfully before many times), the window comes back showing 
> that the tracks have been loaded, but when I click on go to 'genome 
> browser' the tracks don't show up and indeed seem to have disappeared.
> 
> Any suggestions?
> 
> Thanks,
> Bob Waterston

From hiram at soe.ucsc.edu  Fri Jan  4 14:34:37 2008
From: hiram at soe.ucsc.edu (Hiram Clawson)
Date: Fri, 04 Jan 2008 14:34:37 -0800
Subject: [Genome] custom tracks
In-Reply-To: <p06230914c3a42b0a907b@[128.208.26.32]>
References: <p06230914c3a42b0a907b@[128.208.26.32]>
Message-ID: <477EB47D.1070600@soe.ucsc.edu>

You are correct Bob.  I see that they seem to be functioning as usual.

--Hiram

Bob Waterston wrote:
> Dear Folks,
> 
> I'm having trouble with custom tracks.  I load tracks (i've used 
> these successfully before many times), the window comes back showing 
> that the tracks have been loaded, but when I click on go to 'genome 
> browser' the tracks don't show up and indeed seem to have disappeared.
> 
> Any suggestions?
> 
> Thanks,
> Bob Waterston
> 
> ********************
> 
> I just got it to work -- I had opened an old page and had been trying 
> to add from that.  When I went back to home and reopened the worm 
> genome it seems to have righted itself.
> 
> Sorry to have bothered you.
> 
> Bob
> 
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome
> 

From hiram at soe.ucsc.edu  Fri Jan  4 15:33:20 2008
From: hiram at soe.ucsc.edu (Hiram Clawson)
Date: Fri, 04 Jan 2008 15:33:20 -0800
Subject: [Genome] [Fwd: UCSC knownGene database file]
In-Reply-To: <477EBEC4.4060404@ucsc.edu>
References: <477EBEC4.4060404@ucsc.edu>
Message-ID: <477EC240.8060401@soe.ucsc.edu>

Good Afternoon Jeff:

You can read about the process for the current hg18 known gene
procedure in the details page for the known gene track:
	http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg18&g=knownGene

And the previous procedure in the hg17 known gene track:
	http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg17&g=knownGene

Note the "Methods" section on both of the pages.

Please refer your genome questions in the future to the genome email
alias which is copied on this email.

--Hiram

> -------- Original Message --------
> Subject:     UCSC knownGene database file
> Date:     Fri, 04 Jan 2008 11:33:16 -0600
> From:     jeff Nie <nie at wisc.edu>
> CC:     Ron Stewart <rstewart at wicell.org>, shulan Tian <stian at wicell.org>
> 
> 
> 
> Dear Sir/Madam,
> We have just downloaded the hg18  knownGene.txt file from UCSC  download 
> site and found that both format and total gene number  changed. The 
> original hg18  KG set has 39,288 genes, the new set has  56,722 genes. 
> Could you tell us what is the different between these  two versions and 
> any document that we could find to explain this?
> Thanks
> Jeff

From kayla at soe.ucsc.edu  Mon Jan  7 13:42:36 2008
From: kayla at soe.ucsc.edu (Kayla Smith)
Date: Mon, 07 Jan 2008 13:42:36 -0800
Subject: [Genome] highlight multiple items in genome browser
In-Reply-To: <46df4b6d0801062311y32989b08ue075f1cb7588521a@mail.gmail.com>
References: <46df4b6d0801062311y32989b08ue075f1cb7588521a@mail.gmail.com>
Message-ID: <47829CCC.3090205@cse.ucsc.edu>

Hello Tao Peng,

On the SNP details page, which you can get to by clicking on the blue- 
or grey-bar on the left-hand side of the track, there are some options 
for coloring various subsets of SNPs.

Using these controls, you could for example, make all functional 
non-synonymous SNPs "red".

You can also uncheck many of the checkboxes on the details page to 
exclude sets of SNPs from being displayed.

Alternatively, you can create a Custom Track, containing only the data 
that you want.  Here is information on making a Custom Track:
http://genome.ucsc.edu/goldenPath/help/customTrack.html

I hope this information is helpful to you.  Please don't hesitate to 
contact us again if you require further assistance.

Kayla Smith
UCSC Genome Bioinformatics Group


Tao Peng wrote:
> Dear Sir/Madam:
> 
>     I want to explore several SNPs in a region. But there are hundreds of
> them in this region. How can I highlight those I 'm interested in?
> 
>     Querying in the position/search window can highlight one each time. Can
> I highlight multiple items, like SNPs or EST ?
> 
>     Thank you very much!
> 
>              Tao Peng
> 


From dglemay at ucdavis.edu  Sun Jan  6 14:00:21 2008
From: dglemay at ucdavis.edu (Danielle Lemay)
Date: Sun, 06 Jan 2008 14:00:21 -0800
Subject: [Genome] Batch paste of URLs to upload custom tracks not working
Message-ID: <47814F75.3090205@ucdavis.edu>


Hello Team,

If a series of URLs are pasted into the custom track upload window 
(http://genome.ucsc.edu/cgi-bin/hgCustom), they cannot be found ("Error 
not found").  The browser appears to treat the series of URLs as one 
file.  If extra newlines are inserted between the URLs, it works.

Example (non-working):
http://hgwdev.cse.ucsc.edu/~angie/cowGlean/bosTau3.glean52.gff
http://hgwdev.cse.ucsc.edu/~angie/cowGlean/perfect.psl 
http://hgwdev.cse.ucsc.edu/~angie/cowGlean/perfectDupes.psl 
http://hgwdev.cse.ucsc.edu/~angie/cowGlean/prettyGood.psl 
http://hgwdev.cse.ucsc.edu/~angie/cowGlean/missing.psl 
http://hgwdev.cse.ucsc.edu/~angie/cowGlean/nonChrUnPerfectDupes.psl

Example (works):
http://hgwdev.cse.ucsc.edu/~angie/cowGlean/bosTau3.glean52.gff

http://hgwdev.cse.ucsc.edu/~angie/cowGlean/perfect.psl

http://hgwdev.cse.ucsc.edu/~angie/cowGlean/perfectDupes.psl

http://hgwdev.cse.ucsc.edu/~angie/cowGlean/prettyGood.psl

http://hgwdev.cse.ucsc.edu/~angie/cowGlean/missing.psl

http://hgwdev.cse.ucsc.edu/~angie/cowGlean/nonChrUnPerfectDupes.psl

The non-working example previously worked so this is a recently 
introduced bug (in the last 2 months).

Thanks,
Danielle
====================================================
Danielle Lemay
PhD Candidate, Nutritional Biology
German Lab
University of California at Davis
dglemay at ucdavis.edu
(530) 297 7688

From k.askland at gmail.com  Mon Jan  7 11:11:53 2008
From: k.askland at gmail.com (kathleen askland)
Date: Mon, 7 Jan 2008 14:11:53 -0500
Subject: [Genome] (no subject)
Message-ID: <961ec6120801071111l356754fy944b085856f5a052@mail.gmail.com>

Hello,

I was wondering if someone could tell me how I might get the GNF ratio data
wherein missing values are appropriately placed in the sequence of data for
all the tissues (i.e., demarcated by commas on either side). I am trying to
get expression data (ratios), for all replicates, but whether I pull up the
data on the genome browser, or download it as a table, all of the values
available for each tissue are listed consecutively, rather than skipping
values for missing data. Thus, when I import the data, the values are
left-justified, and all the blanks are at the end of the sequence.

Can someone advise on how to get the data already partitioned appropriately?

Thank you,

Kathleen Askland, MD

From kayla at soe.ucsc.edu  Mon Jan  7 17:09:32 2008
From: kayla at soe.ucsc.edu (Kayla Smith)
Date: Mon, 07 Jan 2008 17:09:32 -0800
Subject: [Genome] (no subject)
In-Reply-To: <961ec6120801071111l356754fy944b085856f5a052@mail.gmail.com>
References: <961ec6120801071111l356754fy944b085856f5a052@mail.gmail.com>
Message-ID: <4782CD4C.3040108@cse.ucsc.edu>

Hello Kathleen,

I'm not exactly sure what you're asking for, so correct me if I am 
wrong.  I'm assuming that you're looking at the hg18.gnfAtlas2 table. 
You're looking at the expId and the expScores columns of this table. 
There is also a database hgFixed which has some related gnf data in it, 
which you might be asking about.

Are you trying to retrieve data for only a subset of tissues?
Unfortunately, the expScores field from hg18.gnfAtlas2 is a comma 
separated list and can't be separated with our online tools.  For that 
you'd need to write a program to do the parsing.

If you can indicate which table(s) you're looking at, and an example row 
of data that doesn't look how you expect it to, I can take a closer look 
at figuring out what you need.

I hope this information is helpful to you.  Please don't hesitate to 
contact us again if you require further assistance.

Kayla Smith
UCSC Genome Bioinformatics Group

kathleen askland wrote:
> Hello,
> 
> I was wondering if someone could tell me how I might get the GNF ratio data
> wherein missing values are appropriately placed in the sequence of data for
> all the tissues (i.e., demarcated by commas on either side). I am trying to
> get expression data (ratios), for all replicates, but whether I pull up the
> data on the genome browser, or download it as a table, all of the values
> available for each tissue are listed consecutively, rather than skipping
> values for missing data. Thus, when I import the data, the values are
> left-justified, and all the blanks are at the end of the sequence.
> 
> Can someone advise on how to get the data already partitioned appropriately?
> 
> Thank you,
> 
> Kathleen Askland, MD
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome


From pengtao.arthur at gmail.com  Mon Jan  7 18:50:01 2008
From: pengtao.arthur at gmail.com (Tao Peng)
Date: Tue, 8 Jan 2008 10:50:01 +0800
Subject: [Genome] highlight multiple items in genome browser
In-Reply-To: <47829CCC.3090205@cse.ucsc.edu>
References: <46df4b6d0801062311y32989b08ue075f1cb7588521a@mail.gmail.com>
	<47829CCC.3090205@cse.ucsc.edu>
Message-ID: <46df4b6d0801071850u13c942f9w4d58cd07216841fb@mail.gmail.com>

Thank you for the explanation.

My SNPs can not be filtered out by certain combination of criteria.
Creating a Custom Track can partly solve my problem.

I suggest UCSC genome browser can add this feature, highlighting several
items simultaneously.
Sometimes I want to explore the targets among their neighbors. Constructing
a Custom track will lose the information of those neighbors.

Thank you for you attention.


2008/1/8, Kayla Smith <kayla at soe.ucsc.edu>:
>
> Hello Tao Peng,
>
> On the SNP details page, which you can get to by clicking on the blue-
> or grey-bar on the left-hand side of the track, there are some options
> for coloring various subsets of SNPs.
>
> Using these controls, you could for example, make all functional
> non-synonymous SNPs "red".
>
> You can also uncheck many of the checkboxes on the details page to
> exclude sets of SNPs from being displayed.
>
> Alternatively, you can create a Custom Track, containing only the data
> that you want.  Here is information on making a Custom Track:
> http://genome.ucsc.edu/goldenPath/help/customTrack.html
>
> I hope this information is helpful to you.  Please don't hesitate to
> contact us again if you require further assistance.
>
> Kayla Smith
> UCSC Genome Bioinformatics Group
>
>
> Tao Peng wrote:
> > Dear Sir/Madam:
> >
> >     I want to explore several SNPs in a region. But there are hundreds
> of
> > them in this region. How can I highlight those I 'm interested in?
> >
> >     Querying in the position/search window can highlight one each time.
> Can
> > I highlight multiple items, like SNPs or EST ?
> >
> >     Thank you very much!
> >
> >              Tao Peng
> >
>
>


-- 
Bioinformatics Division, TNLIST, Room 1-108,
Information Science and Technology Building,
Dept. of Automation, Tsinghua Univ.
Beijing,China   100084
E-mail: pengtao.arthur at gmail.com

From remi.terranova at fmi.ch  Tue Jan  8 02:30:38 2008
From: remi.terranova at fmi.ch (Terranova, Remi)
Date: Tue, 8 Jan 2008 11:30:38 +0100
Subject: [Genome] Clone RP23-473N24
References: <4850F76274F80D4D8F6D043FAD35F8270246E815@ex2.fmi.ch>
Message-ID: <4850F76274F80D4D8F6D043FAD35F8270246E816@ex2.fmi.ch>

To whom it may concern,
 
Over the last two years, I have used one clone I chose from UCSC genome browser, RP23-473N24 for FISH analyses. It seems like this clone is not available anymore from the UCSC browser and I wondered what may be wrong with it. 
 
This is important for my purpose as I have based many of my analyses on FISH detection using this BAC clone. I would be grateful if you could tell me whether anything is wrong with this RP23-473N24 clone.
 
With best wishes,
 
Remi Terranova
 
 
RP23-473N24, Mouse Chr7, qF5. Originally located between RP23-71O21 and MSMG01-379L13 
- Assembly: Mouse - March 2005
- Track: BAC End Pairs 
- Kcnq1 locus: chr7: 137,000,000 - 138,000,000
 
 

---------------------------------------------------------------

Dr. R?mi Terranova
Friedrich Miescher Institute (FMI)
Novartis Research foundation
Maulbeerstrasse 66

CH-4058 Basel, Switzerland 

 

Phone: +41 61 697 6100

E-mail: remi.terranova at fmi.ch <mailto:remi.terranova at fmi.ch> 

---------------------------------------------------------------

 
 

*	The name of the assembly (e.g. "hg17", or "human - May 2004") 
*	The name of the track (e.g. "RefSeq Genes") 
*	The exact location you are viewing (e.g. chr7:127,471,196-127,495,720) 

And if the problem seems to be one of display, please include:


*	The name and version of the web browser you are using (e.g. Internet Explorer 6) 
*	The name and version of your operating system (e.g. Microsoft XP) 
*	The series of items you clicked on to reach the problem 


From sselvar1 at asu.edu  Mon Jan  7 23:50:28 2008
From: sselvar1 at asu.edu (SiddarthGautham Selvaraj)
Date: Tue, 8 Jan 2008 00:50:28 -0700
Subject: [Genome] Coding exons of genes in the human genome
Message-ID: <5c826dfc0801072350k4511d382u1a3d7ea4b4f3bf89@mail.gmail.com>

Hi:

I am siddarth, a graduate student in Arizona State University. I have been
trying to get the coding exon sequences of all genes in the human genome.

I define genes as an unit of the genome which codes for something. I do not
need gene variants. That is a gene may get alternatively spliced to produce
different products. I am not bothered on the variants a gene can produce
through alternate splicing.

I tried KnownCanonical Table but I guess it does not focus on all exons.

Thus where can I get information on coding exons of all genes in the human
genome.

Awaiting Your reply

Thanks
siddarth

From ann at soe.ucsc.edu  Tue Jan  8 10:30:31 2008
From: ann at soe.ucsc.edu (Ann Zweig)
Date: Tue, 08 Jan 2008 10:30:31 -0800
Subject: [Genome] Coding exons of genes in the human genome
In-Reply-To: <5c826dfc0801072350k4511d382u1a3d7ea4b4f3bf89@mail.gmail.com>
References: <5c826dfc0801072350k4511d382u1a3d7ea4b4f3bf89@mail.gmail.com>
Message-ID: <4783C147.1010100@soe.ucsc.edu>

Hello Siddarth,

	If you have successfully extracted the sequence for all Known Genes, but you 
only want the sequence for the canonical gene in each gene cluster, then my 
suggestion would be to use the output from the knownCanonical table to filter 
out those genes from your list that you are not interested in.

	If this does not address your issue, please feel free to write back to the 
genome list.


Regards,

----------
Ann Zweig
UCSC Genome Bioinformatics Group
http://genome.ucsc.edu

Please feel free to search the Genome mailing list archives by visiting our home 
page, clicking on "Contact Us", then typing a word or phrase into the search 
box.  On that same page
(http://genome.ucsc.edu/contacts.html), you can subscribe to the Genome mailing 
list.


	

SiddarthGautham Selvaraj wrote:
> Hi:
> 
> I am siddarth, a graduate student in Arizona State University. I have been
> trying to get the coding exon sequences of all genes in the human genome.
> 
> I define genes as an unit of the genome which codes for something. I do not
> need gene variants. That is a gene may get alternatively spliced to produce
> different products. I am not bothered on the variants a gene can produce
> through alternate splicing.
> 
> I tried KnownCanonical Table but I guess it does not focus on all exons.
> 
> Thus where can I get information on coding exons of all genes in the human
> genome.
> 
> Awaiting Your reply
> 
> Thanks
> siddarth
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome

From hiram at soe.ucsc.edu  Tue Jan  8 13:24:49 2008
From: hiram at soe.ucsc.edu (Hiram Clawson)
Date: Tue, 08 Jan 2008 13:24:49 -0800
Subject: [Genome] Clone RP23-473N24
Message-ID: <4783EA21.5050106@soe.ucsc.edu>

Good Afternoon Dr. Terranova:

I am investigating why this clone does not show up on the
UCSC mouse genome browser for July 2007 (UCSC mm9/NCBI 37) compared
to the March 2005 (UCSC mm6/NCBI 34) version.  I do note the
clone end sequences AZ095043 and AZ095046 do map correctly
to the July 2007 sequence in the location: chr7:150,015,500-150,194,000
on the same contig NT_039437 as the March 2005 sequence.

This would indicate this is a valid clone even on the newer assemblies.
I will have to determine why it is missing from the BacEnd track.

Please note, the genome email list is the correct address
for questions on the genome browser.

--Hiram

-------- Original Message --------
Subject: [Genome] Clone RP23-473N24
Date: Tue, 8 Jan 2008 11:30:38 +0100
From: Terranova, Remi <remi.terranova at fmi.ch>
To: <genome at soe.ucsc.edu>

To whom it may concern,

Over the last two years, I have used one clone I chose from UCSC genome browser, RP23-473N24 for FISH analyses. It seems like this 
clone is not available anymore from the UCSC browser and I wondered what may be wrong with it.

This is important for my purpose as I have based many of my analyses on FISH detection using this BAC clone. I would be grateful if 
you could tell me whether anything is wrong with this RP23-473N24 clone.

With best wishes,

Remi Terranova


RP23-473N24, Mouse Chr7, qF5. Originally located between RP23-71O21 and MSMG01-379L13
- Assembly: Mouse - March 2005
- Track: BAC End Pairs
- Kcnq1 locus: chr7: 137,000,000 - 138,000,000

---------------------------------------------------------------

Dr. R?mi Terranova
Friedrich Miescher Institute (FMI)
Novartis Research foundation
Maulbeerstrasse 66

CH-4058 Basel, Switzerland

Phone: +41 61 697 6100

From wanglunju at gmail.com  Tue Jan  8 23:36:11 2008
From: wanglunju at gmail.com (=?GB2312?B?zfXotA==?=)
Date: Wed, 9 Jan 2008 15:36:11 +0800
Subject: [Genome] found a puzzle in your database
In-Reply-To: <14ad659e0801082228x1d12e861x1cf3eab7e0a9ec76@mail.gmail.com>
References: <14ad659e0801082228x1d12e861x1cf3eab7e0a9ec76@mail.gmail.com>
Message-ID: <14ad659e0801082336v3b2d6a02u7f4248ffb9b0fef4@mail.gmail.com>

Dear principal of *UCSC Genome Bioinformatics Group:*
*        *I am a graduate student of Nanjing University of China,and my
major is bio-chemistry.Now my job is about the promoter of mouse PRL-3 gene(
*ENSMUSG00000059895* ).
        In your database, the introns of  this gene are about 30kb,but in
the database of Ensemble,the gene structure is different(in a picture of
accessory).I figured out that the difference is the first intron.In your
database,there is a 26kb intron at the beginning of the gene,but in the
Ensemble database the gene does not contain this intron.
        Maybe I made a mistake when I am searching for this gene,then, can
you tell me where is the position of transcriptional starting point of  this
gene?
        Soryy to put you in the trouble of this puzzle,but I really hope
that you can help me.Thank you!
        Best wishes.

Yours

                      Wang Lu

From kayla at soe.ucsc.edu  Wed Jan  9 10:29:48 2008
From: kayla at soe.ucsc.edu (Kayla Smith)
Date: Wed, 09 Jan 2008 10:29:48 -0800
Subject: [Genome] highlight multiple items in genome browser
In-Reply-To: <46df4b6d0801071850u13c942f9w4d58cd07216841fb@mail.gmail.com>
References: <46df4b6d0801062311y32989b08ue075f1cb7588521a@mail.gmail.com>	
	<47829CCC.3090205@cse.ucsc.edu>
	<46df4b6d0801071850u13c942f9w4d58cd07216841fb@mail.gmail.com>
Message-ID: <4785129C.6080602@cse.ucsc.edu>


Hello Tao Peng,

Thank you for your suggestion.  We will consider it for a future release.

Kayla Smith
UCSC Genome Bioinformatics Group


Tao Peng wrote:
> Thank you for the explanation.
> 
> My SNPs can not be filtered out by certain combination of criteria.
> Creating a Custom Track can partly solve my problem.
> 
> I suggest UCSC genome browser can add this feature, highlighting several 
> items simultaneously.
> Sometimes I want to explore the targets among their neighbors. 
> Constructing a Custom track will lose the information of those neighbors.
> 
> Thank you for you attention.
> 
> 
> 2008/1/8, Kayla Smith < kayla at soe.ucsc.edu <mailto:kayla at soe.ucsc.edu>>:
> 
>     Hello Tao Peng,
> 
>     On the SNP details page, which you can get to by clicking on the blue-
>     or grey-bar on the left-hand side of the track, there are some options
>     for coloring various subsets of SNPs.
> 
>     Using these controls, you could for example, make all functional
>     non-synonymous SNPs "red".
> 
>     You can also uncheck many of the checkboxes on the details page to
>     exclude sets of SNPs from being displayed.
> 
>     Alternatively, you can create a Custom Track, containing only the data
>     that you want.  Here is information on making a Custom Track:
>     http://genome.ucsc.edu/goldenPath/help/customTrack.html
> 
>     I hope this information is helpful to you.  Please don't hesitate to
>     contact us again if you require further assistance.
> 
>     Kayla Smith
>     UCSC Genome Bioinformatics Group
> 
> 
>     Tao Peng wrote:
>      > Dear Sir/Madam:
>      >
>      >     I want to explore several SNPs in a region. But there are
>     hundreds of
>      > them in this region. How can I highlight those I 'm interested in?
>      >
>      >     Querying in the position/search window can highlight one each
>     time. Can
>      > I highlight multiple items, like SNPs or EST ?
>      >
>      >     Thank you very much!
>      >
>      >              Tao Peng
>      >
> 
> 
> 
> 
> -- 
> Bioinformatics Division, TNLIST, Room 1-108,
> Information Science and Technology Building,
> Dept. of Automation, Tsinghua Univ.
> Beijing,China   100084
> E-mail: pengtao.arthur at gmail.com <mailto:pengtao.arthur at gmail.com>


From viswanathl at mail.nih.gov  Wed Jan  9 10:44:59 2008
From: viswanathl at mail.nih.gov (Viswanath, Lalitha (NIH/NCI) [C])
Date: Wed, 9 Jan 2008 13:44:59 -0500
Subject: [Genome] Is the UCSC FTP Server down?
Message-ID: <C21F7E80A3ABEB42A06ABF2FFE6B4024904C08@NIHCESMLBX11.nih.gov>

Hi

I am encountering error message 

Error in server response, closing control connection.

Error in server response, closing control connection.

When trying to download 

wget -nv
ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/cytoBand.txt.gz

 

Thanks

Lalitha


From hiram at soe.ucsc.edu  Wed Jan  9 11:19:09 2008
From: hiram at soe.ucsc.edu (Hiram Clawson)
Date: Wed, 09 Jan 2008 11:19:09 -0800
Subject: [Genome] Is the UCSC FTP Server down?
In-Reply-To: <C21F7E80A3ABEB42A06ABF2FFE6B4024904C08@NIHCESMLBX11.nih.gov>
References: <C21F7E80A3ABEB42A06ABF2FFE6B4024904C08@NIHCESMLBX11.nih.gov>
Message-ID: <47851E2D.6030000@soe.ucsc.edu>

Thank you for the report.  Our FTP server was hung up due to
too many connections.  Evidently the back-log of requests from
our outage last week is stressing the system.

--Hiram

Viswanath, Lalitha (NIH/NCI) [C] wrote:
> Hi
> 
> I am encountering error message 
> 
> Error in server response, closing control connection.
> 
> Error in server response, closing control connection.
> 
> When trying to download 
> 
> wget -nv
> ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/cytoBand.txt.gz
> 
>  
> 
> Thanks
> 
> Lalitha

From kuhn at soe.ucsc.edu  Wed Jan  9 11:55:43 2008
From: kuhn at soe.ucsc.edu (Robert Kuhn)
Date: Wed, 9 Jan 2008 11:55:43 -0800
Subject: [Genome] Is the UCSC FTP Server down?
Message-ID: <200801091955.LAA26414@sundance.cse.ucsc.edu>

Lalitha,

You may be able to get the file you need via the mysql
site, as it is very small.

mysql -h genome-mysql -u genome -A hg18 -e "SELECT * FROM cytoBand" > cytoBand.txt

best wishes,

			--b0b kuhn
			ucsc genome bioinformatics group

> From genome-bounces at soe.ucsc.edu  Wed Jan  9 11:19:39 2008
> To: "Viswanath, Lalitha (NIH/NCI) [C]" <viswanathl at mail.nih.gov>
> Cc: genome at soe.ucsc.edu
> Subject: Re: [Genome] Is the UCSC FTP Server down?
> 
> Thank you for the report.  Our FTP server was hung up due to
> too many connections.  Evidently the back-log of requests from
> our outage last week is stressing the system.
> 
> --Hiram
> 
> Viswanath, Lalitha (NIH/NCI) [C] wrote:
> > Hi
> > 
> > I am encountering error message 
> > 
> > Error in server response, closing control connection.
> > 
> > Error in server response, closing control connection.
> > 
> > When trying to download 
> > 
> > wget -nv
> > ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/cytoBand.txt.gz
> > 
> >  
> > 
> > Thanks
> > 
> > Lalitha
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome
> 

From sselvar1 at asu.edu  Wed Jan  9 13:03:36 2008
From: sselvar1 at asu.edu (SiddarthGautham Selvaraj)
Date: Wed, 9 Jan 2008 14:03:36 -0700
Subject: [Genome] Coding exons of genes in the human genome
In-Reply-To: <4783C147.1010100@soe.ucsc.edu>
References: <5c826dfc0801072350k4511d382u1a3d7ea4b4f3bf89@mail.gmail.com>
	<4783C147.1010100@soe.ucsc.edu>
Message-ID: <5c826dfc0801091303s58f400c2k2e066d7f490ef820@mail.gmail.com>

Hi,


I am a graduate student from Arizona State University. I am trying to
extract the list of canonical genes from KnownCanonical table. To do that, I
first need to organize genes based on gene symbols.

The values contained as gene symbol in kgXref table are not very precise. It
has entries like

 1-Mar  2-Mar  3-Mar  4-Mar  5-Mar  6-Mar  7-Mar  8-Mar  9-Mar  1-Sep  2-Sep
3-Sep  4-Sep  5-Sep  6-Sep  7-Sep  8-Sep  9-Sep  10-Sep  11-Sep  12-Sep
15-Sep  1-Dec and

 C10orf10  C10orf104  C10orf107  C10orf108  C10orf11  C10orf110  C10orf111
C10orf113  C10orf114  C10orf116  C10orf118  C10orf119  C10orf12  C10orf120
C10orf122  C10orf125  C10orf129  C10orf130  C10orf132  C10orf137  C10orf18
C10orf22  C10orf25  C10orf26  C10orf27  C10orf28  C10orf30  C10orf32
C10orf33  C10orf35  C10orf38  C10orf4  C10orf46  C10orf47  C10orf49
C10orf53  C10orf54  C10orf55  C10orf56  C10orf57  C10orf58  C10orf59
C10orf6  C10orf61  C10orf62  C10orf63  C10orf64  C10orf65  C10orf67
C10orf68  C10orf71  C10orf72  C10orf73  C10orf76  C10orf78
which I guess are junk entries. Thus I would require HGNC symbols from some
other table so that I can compare these values and get only the proper gene
symbols and hence proper genes.

Please let me know which table has the HGNC symbols.

Please help me in this.

Thanks
siddarth

On 08/01/2008, Ann Zweig <ann at soe.ucsc.edu> wrote:
>
> Hello Siddarth,
>
>         If you have successfully extracted the sequence for all Known
> Genes, but you
> only want the sequence for the canonical gene in each gene cluster, then
> my
> suggestion would be to use the output from the knownCanonical table to
> filter
> out those genes from your list that you are not interested in.
>
>         If this does not address your issue, please feel free to write
> back to the
> genome list.
>
>
> Regards,
>
> ----------
> Ann Zweig
> UCSC Genome Bioinformatics Group
> http://genome.ucsc.edu
>
> Please feel free to search the Genome mailing list archives by visiting
> our home
> page, clicking on "Contact Us", then typing a word or phrase into the
> search
> box.  On that same page
> (http://genome.ucsc.edu/contacts.html), you can subscribe to the Genome
> mailing
> list.
>
>
>
>
> SiddarthGautham Selvaraj wrote:
> > Hi:
> >
> > I am siddarth, a graduate student in Arizona State University. I have
> been
> > trying to get the coding exon sequences of all genes in the human
> genome.
> >
> > I define genes as an unit of the genome which codes for something. I do
> not
> > need gene variants. That is a gene may get alternatively spliced to
> produce
> > different products. I am not bothered on the variants a gene can produce
> > through alternate splicing.
> >
> > I tried KnownCanonical Table but I guess it does not focus on all exons.
> >
> > Thus where can I get information on coding exons of all genes in the
> human
> > genome.
> >
> > Awaiting Your reply
> >
> > Thanks
> > siddarth
> > _______________________________________________
> > Genome maillist  -  Genome at soe.ucsc.edu
> > http://www.soe.ucsc.edu/mailman/listinfo/genome
>

From rhead at soe.ucsc.edu  Wed Jan  9 13:34:09 2008
From: rhead at soe.ucsc.edu (Brooke Rhead)
Date: Wed, 09 Jan 2008 13:34:09 -0800
Subject: [Genome] Coding exons of genes in the human genome
In-Reply-To: <5c826dfc0801091303s58f400c2k2e066d7f490ef820@mail.gmail.com>
References: <5c826dfc0801072350k4511d382u1a3d7ea4b4f3bf89@mail.gmail.com>	<4783C147.1010100@soe.ucsc.edu>
	<5c826dfc0801091303s58f400c2k2e066d7f490ef820@mail.gmail.com>
Message-ID: <47853DD1.7050508@soe.ucsc.edu>

Hi Siddarth,

Are you using the hg18 database?  I do not see any entries in the 
hg18.kgXref table like '1-Mar' or 'C10orf10'.

Is the kgXref table you are using identical to the one located here?:
http://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/kgXref.txt.gz

--
Brooke Rhead
UCSC Genome Bioinformatics Group


SiddarthGautham Selvaraj wrote:
> Hi,
> 
> 
> I am a graduate student from Arizona State University. I am trying to
> extract the list of canonical genes from KnownCanonical table. To do that, I
> first need to organize genes based on gene symbols.
> 
> The values contained as gene symbol in kgXref table are not very precise. It
> has entries like
> 
>  1-Mar  2-Mar  3-Mar  4-Mar  5-Mar  6-Mar  7-Mar  8-Mar  9-Mar  1-Sep  2-Sep
> 3-Sep  4-Sep  5-Sep  6-Sep  7-Sep  8-Sep  9-Sep  10-Sep  11-Sep  12-Sep
> 15-Sep  1-Dec and
> 
>  C10orf10  C10orf104  C10orf107  C10orf108  C10orf11  C10orf110  C10orf111
> C10orf113  C10orf114  C10orf116  C10orf118  C10orf119  C10orf12  C10orf120
> C10orf122  C10orf125  C10orf129  C10orf130  C10orf132  C10orf137  C10orf18
> C10orf22  C10orf25  C10orf26  C10orf27  C10orf28  C10orf30  C10orf32
> C10orf33  C10orf35  C10orf38  C10orf4  C10orf46  C10orf47  C10orf49
> C10orf53  C10orf54  C10orf55  C10orf56  C10orf57  C10orf58  C10orf59
> C10orf6  C10orf61  C10orf62  C10orf63  C10orf64  C10orf65  C10orf67
> C10orf68  C10orf71  C10orf72  C10orf73  C10orf76  C10orf78
> which I guess are junk entries. Thus I would require HGNC symbols from some
> other table so that I can compare these values and get only the proper gene
> symbols and hence proper genes.
> 
> Please let me know which table has the HGNC symbols.
> 
> Please help me in this.
> 
> Thanks
> siddarth
> 
> On 08/01/2008, Ann Zweig <ann at soe.ucsc.edu> wrote:
>> Hello Siddarth,
>>
>>         If you have successfully extracted the sequence for all Known
>> Genes, but you
>> only want the sequence for the canonical gene in each gene cluster, then
>> my
>> suggestion would be to use the output from the knownCanonical table to
>> filter
>> out those genes from your list that you are not interested in.
>>
>>         If this does not address your issue, please feel free to write
>> back to the
>> genome list.
>>
>>
>> Regards,
>>
>> ----------
>> Ann Zweig
>> UCSC Genome Bioinformatics Group
>> http://genome.ucsc.edu
>>
>> Please feel free to search the Genome mailing list archives by visiting
>> our home
>> page, clicking on "Contact Us", then typing a word or phrase into the
>> search
>> box.  On that same page
>> (http://genome.ucsc.edu/contacts.html), you can subscribe to the Genome
>> mailing
>> list.
>>
>>
>>
>>
>> SiddarthGautham Selvaraj wrote:
>>> Hi:
>>>
>>> I am siddarth, a graduate student in Arizona State University. I have
>> been
>>> trying to get the coding exon sequences of all genes in the human
>> genome.
>>> I define genes as an unit of the genome which codes for something. I do
>> not
>>> need gene variants. That is a gene may get alternatively spliced to
>> produce
>>> different products. I am not bothered on the variants a gene can produce
>>> through alternate splicing.
>>>
>>> I tried KnownCanonical Table but I guess it does not focus on all exons.
>>>
>>> Thus where can I get information on coding exons of all genes in the
>> human
>>> genome.
>>>
>>> Awaiting Your reply
>>>
>>> Thanks
>>> siddarth
>>> _______________________________________________
>>> Genome maillist  -  Genome at soe.ucsc.edu
>>> http://www.soe.ucsc.edu/mailman/listinfo/genome
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome

From sselvar1 at asu.edu  Wed Jan  9 14:29:08 2008
From: sselvar1 at asu.edu (SiddarthGautham Selvaraj)
Date: Wed, 9 Jan 2008 15:29:08 -0700
Subject: [Genome] HGNC or HUGO Symbols
Message-ID: <5c826dfc0801091429m6b151a0fm7c04682de62482ae@mail.gmail.com>

Hi:

I am using the hg18 database. I am using only the gene symbol field of the
table KgXref.

You can find entries like MARCH1, MARCH5, etc. The gene symbol field also
has entries like C10orf10, etc.

I have learnt that the field contains actual gene symbols, sometime
swiss-prot id and sometimes something else.

Under what consitions, values other than gene symbol are given in the 'Gene
Symbol' field of the table KgXref?

Also please let me know if some table has the HGNC symbols or HUGO symbols
so that I can extract exactly those entries that have Gene symbols in the
field 'gene symbol' of the table KgXref.

Thanks
siddarth

From rhead at soe.ucsc.edu  Wed Jan  9 14:53:53 2008
From: rhead at soe.ucsc.edu (Brooke Rhead)
Date: Wed, 09 Jan 2008 14:53:53 -0800
Subject: [Genome] HGNC or HUGO Symbols
In-Reply-To: <5c826dfc0801091429m6b151a0fm7c04682de62482ae@mail.gmail.com>
References: <5c826dfc0801091429m6b151a0fm7c04682de62482ae@mail.gmail.com>
Message-ID: <47855081.2050309@soe.ucsc.edu>

Hi Siddarth,

Pardon me, I did not see the names like 'C10orf10' in my original search 
of kgXref.  I see them now.

When there is a HGNC (HUGO) Gene Symbol available, it will appear in 
this field of this table: kgXref.geneSymbol.  Not all genes in the 
knownGene table have a HGNC Gene Symbol assigned.

There is another table in the 'proteome' database that contains HUGO 
gene symbols and HGNC IDs: 'hgncXref'.

One of our team members has developed a MySQL database query that will
retrieve the HGNC gene symbols mapped to the knownGene transcript name:

SELECT geneSymbol,transcript
FROM knownCanonical,kgXref,proteome.hgncXref
WHERE kgXref.kgID=knownCanonical.transcript
AND kgXref.geneSymbol = proteome.hgncXref.symbol

Also, here are some previously answered questions that pertain to 
getting HUGO gene names from our tables:

http://www.soe.ucsc.edu/pipermail/genome/2006-April/010350.html
https://www.soe.ucsc.edu/pipermail/genome/2006-September/011570.html

I hope this information is helpful.

-- 
Brooke Rhead
UCSC Genome Bioinformatics Group



SiddarthGautham Selvaraj wrote:
> Hi:
> 
> I am using the hg18 database. I am using only the gene symbol field of the
> table KgXref.
> 
> You can find entries like MARCH1, MARCH5, etc. The gene symbol field also
> has entries like C10orf10, etc.
> 
> I have learnt that the field contains actual gene symbols, sometime
> swiss-prot id and sometimes something else.
> 
> Under what consitions, values other than gene symbol are given in the 'Gene
> Symbol' field of the table KgXref?
> 
> Also please let me know if some table has the HGNC symbols or HUGO symbols
> so that I can extract exactly those entries that have Gene symbols in the
> field 'gene symbol' of the table KgXref.
> 
> Thanks
> siddarth
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome

From elana.miriami at yale.edu  Wed Jan  9 14:48:35 2008
From: elana.miriami at yale.edu (Miriami Elana)
Date: Wed, 09 Jan 2008 17:48:35 -0500
Subject: [Genome] question: non-protein coding genes
Message-ID: <20080109174835.zx7q85uem8o0o0s0@www.mail.yale.edu>

Hello,

I am interested in non-protein coding genes from all Known Genes (the
coordinates
in a bed file with the name of the gene). How can I get it using the UCSC genome
browser?

Thank you very much,

Miriami Elana
Yale University
Department of Biology and MCB
219 Prospect St
New Haven, CT 06511
USA

From rhead at soe.ucsc.edu  Wed Jan  9 15:27:42 2008
From: rhead at soe.ucsc.edu (Brooke Rhead)
Date: Wed, 09 Jan 2008 15:27:42 -0800
Subject: [Genome] question: non-protein coding genes
In-Reply-To: <20080109174835.zx7q85uem8o0o0s0@www.mail.yale.edu>
References: <20080109174835.zx7q85uem8o0o0s0@www.mail.yale.edu>
Message-ID: <4785586E.7010001@soe.ucsc.edu>

Hello Elana,

To get all of the non-protein-coding UCSC Genes in BED format, go to the 
Table Browser (the "Tables" link at the top of the page) and select the 
clade, genome and assembly of interest.  Then select:

group: Genes and Gene Prediction Tracks
track: UCSC Genes
table: knownGene
region: genome
output format: BED - Browser Extensible Data
output file: enter a filename to save the results to your computer

Then hit the "filter: create" button, and in the free-form query box 
enter: cdsStart=cdsEnd and hit submit.  Now hit "get output".

Note that only the "UCSC Genes" tracks in hg18 and mm9 contain 
non-protein-coding genes (the older "Known Genes" tracks do not).

If you have further questions, please feel free to write back to this 
mailing list address.

--
Brooke Rhead
UCSC Genome Bioinformatics Group


Miriami Elana wrote:
> Hello,
> 
> I am interested in non-protein coding genes from all Known Genes (the
> coordinates
> in a bed file with the name of the gene). How can I get it using the UCSC genome
> browser?
> 
> Thank you very much,
> 
> Miriami Elana
> Yale University
> Department of Biology and MCB
> 219 Prospect St
> New Haven, CT 06511
> USA
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome

From rhead at soe.ucsc.edu  Wed Jan  9 15:49:42 2008
From: rhead at soe.ucsc.edu (Brooke Rhead)
Date: Wed, 09 Jan 2008 15:49:42 -0800
Subject: [Genome] HGNC or HUGO Symbols
In-Reply-To: <47855081.2050309@soe.ucsc.edu>
References: <5c826dfc0801091429m6b151a0fm7c04682de62482ae@mail.gmail.com>
	<47855081.2050309@soe.ucsc.edu>
Message-ID: <47855D96.5060803@soe.ucsc.edu>

Hello again Siddarth,

A colleague has pointed out that the names like MARCH1 and C10orf10 are 
indeed approved gene symbols in HUGO/HGNC.

If you look them up at http://www.genenames.org/ you will see entries 
for them:

MARCH1 = membrane-associated ring finger (C3HC4) 1
C10orf10 = chromosome 10 open reading frame 10

--
Brooke Rhead
UCSC Genome Bioinformatics Group


Brooke Rhead wrote:
> Hi Siddarth,
> 
> Pardon me, I did not see the names like 'C10orf10' in my original search 
> of kgXref.  I see them now.
> 
> When there is a HGNC (HUGO) Gene Symbol available, it will appear in 
> this field of this table: kgXref.geneSymbol.  Not all genes in the 
> knownGene table have a HGNC Gene Symbol assigned.
> 
> There is another table in the 'proteome' database that contains HUGO 
> gene symbols and HGNC IDs: 'hgncXref'.
> 
> One of our team members has developed a MySQL database query that will
> retrieve the HGNC gene symbols mapped to the knownGene transcript name:
> 
> SELECT geneSymbol,transcript
> FROM knownCanonical,kgXref,proteome.hgncXref
> WHERE kgXref.kgID=knownCanonical.transcript
> AND kgXref.geneSymbol = proteome.hgncXref.symbol
> 
> Also, here are some previously answered questions that pertain to 
> getting HUGO gene names from our tables:
> 
> http://www.soe.ucsc.edu/pipermail/genome/2006-April/010350.html
> https://www.soe.ucsc.edu/pipermail/genome/2006-September/011570.html
> 
> I hope this information is helpful.
> 

From ann at soe.ucsc.edu  Wed Jan  9 16:05:11 2008
From: ann at soe.ucsc.edu (Ann Zweig)
Date: Wed, 09 Jan 2008 16:05:11 -0800
Subject: [Genome] Clone RP23-473N24
In-Reply-To: <4783EA21.5050106@soe.ucsc.edu>
References: <4783EA21.5050106@soe.ucsc.edu>
Message-ID: <47856137.50001@cse.ucsc.edu>

Hello Remi,

	We have added this clone to the mm9 BAC End Pairs annotation track.

Regards,

----------
Ann Zweig
UCSC Genome Bioinformatics Group
http://genome.ucsc.edu


Hiram Clawson wrote:
> Good Afternoon Dr. Terranova:
> 
> I am investigating why this clone does not show up on the
> UCSC mouse genome browser for July 2007 (UCSC mm9/NCBI 37) compared
> to the March 2005 (UCSC mm6/NCBI 34) version.  I do note the
> clone end sequences AZ095043 and AZ095046 do map correctly
> to the July 2007 sequence in the location: chr7:150,015,500-150,194,000
> on the same contig NT_039437 as the March 2005 sequence.
> 
> This would indicate this is a valid clone even on the newer assemblies.
> I will have to determine why it is missing from the BacEnd track.
> 
> Please note, the genome email list is the correct address
> for questions on the genome browser.
> 
> --Hiram
> 
> -------- Original Message --------
> Subject: [Genome] Clone RP23-473N24
> Date: Tue, 8 Jan 2008 11:30:38 +0100
> From: Terranova, Remi <remi.terranova at fmi.ch>
> To: <genome at soe.ucsc.edu>
> 
> To whom it may concern,
> 
> Over the last two years, I have used one clone I chose from UCSC genome browser, RP23-473N24 for FISH analyses. It seems like this 
> clone is not available anymore from the UCSC browser and I wondered what may be wrong with it.
> 
> This is important for my purpose as I have based many of my analyses on FISH detection using this BAC clone. I would be grateful if 
> you could tell me whether anything is wrong with this RP23-473N24 clone.
> 
> With best wishes,
> 
> Remi Terranova
> 
> 
> RP23-473N24, Mouse Chr7, qF5. Originally located between RP23-71O21 and MSMG01-379L13
> - Assembly: Mouse - March 2005
> - Track: BAC End Pairs
> - Kcnq1 locus: chr7: 137,000,000 - 138,000,000
> 
> ---------------------------------------------------------------
> 
> Dr. R?mi Terranova
> Friedrich Miescher Institute (FMI)
> Novartis Research foundation
> Maulbeerstrasse 66
> 
> CH-4058 Basel, Switzerland
> 
> Phone: +41 61 697 6100
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome

From arhan at ucla.edu  Wed Jan  9 16:19:08 2008
From: arhan at ucla.edu (Areum Han)
Date: Wed, 9 Jan 2008 16:19:08 -0800
Subject: [Genome] download of spliced_Est annotation
Message-ID: <003d01c8531e$6b330850$8a2743a4@AreumHan>

The spliced_Est annotation for mm is downloadable?
or need to be downloaded a crhom by chrom?

From rhead at soe.ucsc.edu  Wed Jan  9 17:14:48 2008
From: rhead at soe.ucsc.edu (Brooke Rhead)
Date: Wed, 09 Jan 2008 17:14:48 -0800
Subject: [Genome] download of spliced_Est annotation
In-Reply-To: <003d01c8531e$6b330850$8a2743a4@AreumHan>
References: <003d01c8531e$6b330850$8a2743a4@AreumHan>
Message-ID: <47857188.2030901@soe.ucsc.edu>

Hello Areum Han,

The tables underlying the Spliced ESTs track are indeed split into 
chromosomes on our downloads page 
(http://hgdownload.cse.ucsc.edu/goldenPath/mm9/database/).

However, you can get all of the split tables at once using the Table 
Browser.  Hit the blue "Tables" link at the top of the page, and choose 
the mouse assembly you wish to use from the drop-down menus.  Then select:

group: mRNA and EST tracks
track: Spliced ESTs
table: intronEst
region: genome
output format: all fields from selected table
output file: enter a file name here
file type returned: gzip compressed

and hit "get output".  When compressed, the file is about 63 Mbytes (for 
the mm9 assembly).

--
Brooke Rhead
UCSC Genome Bioinformatics Group


Areum Han wrote:
> The spliced_Est annotation for mm is downloadable?
> or need to be downloaded a crhom by chrom?
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome

From Mike.Mitchell at cancer.org.uk  Thu Jan 10 06:23:28 2008
From: Mike.Mitchell at cancer.org.uk (Mike Mitchell)
Date: Thu, 10 Jan 2008 14:23:28 +0000
Subject: [Genome] Batch extraction
Message-ID: <C3ABDAE0.DE87%Mike.Mitchell@cancer.org.uk>

Hello!,

I have a list of 90+ regions for which I would would like to extract data
from the TableBrowser.

If I upload these regions into the "define regions" interface the data I get
back doesn't (seem to) identify which region any particular RefGene is
within.

I could c&p each region into the tablebrowser and do the 90+ searches in
turn, but that will be laborious (and no doubt prone to human error.) Is
there a way to do a "batch" TableBrowser query? Or is there a better tool I
could use?

Thanks in advance for your time and help.

-- 

Mike Mitchell
Bioinformatics & Biostatistics Service
Cancer Research UK +44 (0) 207 269 3115

+++ Divide By Cucumber Error. Please Reinstall Universe And Reboot +++


From peter.shepard at gmail.com  Thu Jan 10 07:43:47 2008
From: peter.shepard at gmail.com (Pete Shepard)
Date: Thu, 10 Jan 2008 07:43:47 -0800
Subject: [Genome] go term level
Message-ID: <5c2c43620801100743k317b00d8wf61d84f7cca739dc@mail.gmail.com>

Good Morning Browser Folks,

I am using the Table Browser to extract GO terms for a number of genes from
go.goaPart table and joining this with the go.term field. I am hoping to get
the level of each term in the ontology. For example, if I enter a single
Trembleid=dbObjectId (O00139) I get the following output for the cellular
component ontology:

#go.goaPart.dbObjectId	go.goaPart.dbObjectSymbol	go.goaPart.aspect	go.term.name	go.term.term_type	go.term.acc
O00139	KIF2A_HUMAN	C	cytoskeleton	cellular_component	GO:0005856
O00139	KIF2A_HUMAN	C	microtubule	cellular_component	GO:0005874
O00139	KIF2A_HUMAN	C	microtubule associated
complex	cellular_component	GO:0005875



I am hoping to get the term at the highest level for each ontology. Is
there a way to accomplish this such as a number associated with each
term.

Thank you.

From darnelr at mail.rockefeller.edu  Thu Jan 10 08:37:33 2008
From: darnelr at mail.rockefeller.edu (Robert Darnell)
Date: Thu, 10 Jan 2008 11:37:33 -0500
Subject: [Genome] Genome graph window size
Message-ID: <9D306E9B-AB4F-416C-BDBE-16EA7495E40E@rockefeller.edu>

Hi:

I'm a molecular biologist (so have mercy please) interested in trying  
to graph BED files uploaded into Genome Graphs, but to have the data  
plotted in a narrower window than 10,000bp; even 1,000 bp would be an  
improvement I think for our data, or, optimally, 100bp.  Is this  
impossible because of computation time, or feasible?

Thanks,

Bob
_________________________________
Robert B. Darnell
The Rockefeller University



From hiram at soe.ucsc.edu  Thu Jan 10 10:46:21 2008
From: hiram at soe.ucsc.edu (Hiram Clawson)
Date: Thu, 10 Jan 2008 10:46:21 -0800
Subject: [Genome] Genome graph window size
In-Reply-To: <9D306E9B-AB4F-416C-BDBE-16EA7495E40E@rockefeller.edu>
References: <9D306E9B-AB4F-416C-BDBE-16EA7495E40E@rockefeller.edu>
Message-ID: <478667FD.7060402@soe.ucsc.edu>

Good Morning Robert:

If your data can be calculated to a consistent window size,
say one data point for every 100bp, you can use the
wiggle format to view the data in the genome browser:
http://genome.ucsc.edu/goldenPath/help/wiggle.html

The genome graphs are whole genome viewpoints and wouldn't
be able to show your data detail below a couple 100 thousand
bases.  Unless you view them in the genome browser, where
you could instead view them as wiggle data plots.

Wiggle data points are bar graphs at the specified
locations with the bars of size "span".  (span must
be consistent)  Whereas, the genome graph data
points are points on a line graph.  They are different
types of graphs.  The wiggle data can be fudged into
looking like a line graph by setting the graph
options to "points" (actually the lines of the tops
of the bars) and set smoothing on to smear those little
line segments into a continuous looking line.

--Hiram

Robert Darnell wrote:
> Hi:
> 
> I'm a molecular biologist (so have mercy please) interested in trying  
> to graph BED files uploaded into Genome Graphs, but to have the data  
> plotted in a narrower window than 10,000bp; even 1,000 bp would be an  
> improvement I think for our data, or, optimally, 100bp.  Is this  
> impossible because of computation time, or feasible?
> 
> Thanks,
> 
> Bob
> _________________________________
> Robert B. Darnell
> The Rockefeller University
> 
> 
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome
> 


From galt at soe.ucsc.edu  Thu Jan 10 11:20:55 2008
From: galt at soe.ucsc.edu (Galt Barber)
Date: Thu, 10 Jan 2008 11:20:55 -0800 (PST)
Subject: [Genome] Genome graph window size
In-Reply-To: <478667FD.7060402@soe.ucsc.edu>
References: <9D306E9B-AB4F-416C-BDBE-16EA7495E40E@rockefeller.edu>
	<478667FD.7060402@soe.ucsc.edu>
Message-ID: <Pine.GSO.4.58.0801101102440.19708@sundance.cse.ucsc.edu>


Genome Graphs

If you convert your BED file with a script to the
native Genome Graphs custom file format, which is
very simple, e.g.
chr pos value
chr12 120000 1

You can have up to millions of points, although
it was designed expecting more like hundreds of thousands.

If you only plot the peaks and they are all the
same value, you won't see them, but by adding a
few points around your peak you can give it definition.
i.e.
chr12 120000 1
chr12 130000 1
chr12 140000 1
chr12 150000 1
Since it just connects the dots,
definining only the peaks doesn't work.
It just joins them into a what looks like a single line.
(There is also a user-configurable limit value
that causes it to not connect two dots further apart
than the max #bp you specify.)

However, if you had features that are
say 100 bp wide and non-overlapping,
you can define each peaks with multiple points like this:
chr12 120000 0
chr12 120001 1
chr12 120099 1
chr12 120100 0
And now you have a square peak 100bp wide.

If you prefer a triangular peak, you could do this:
chr12 120000 0
chr12 120050 1
chr12 120100 0

Note that the genome graphs display has a limited
number of pixels so that you are probably looking
at roughly thousands of bp per pixel.

But when you click on it to go through to the
genome-browser, you will be able to zoom in to
any level of detail.

-Galt


On Thu, 10 Jan 2008, Hiram Clawson wrote:

> Good Morning Robert:
>
> If your data can be calculated to a consistent window size,
> say one data point for every 100bp, you can use the
> wiggle format to view the data in the genome browser:
> http://genome.ucsc.edu/goldenPath/help/wiggle.html
>
> The genome graphs are whole genome viewpoints and wouldn't
> be able to show your data detail below a couple 100 thousand
> bases.  Unless you view them in the genome browser, where
> you could instead view them as wiggle data plots.
>
> Wiggle data points are bar graphs at the specified
> locations with the bars of size "span".  (span must
> be consistent)  Whereas, the genome graph data
> points are points on a line graph.  They are different
> types of graphs.  The wiggle data can be fudged into
> looking like a line graph by setting the graph
> options to "points" (actually the lines of the tops
> of the bars) and set smoothing on to smear those little
> line segments into a continuous looking line.
>
> --Hiram
>
> Robert Darnell wrote:
> > Hi:
> >
> > I'm a molecular biologist (so have mercy please) interested in trying
> > to graph BED files uploaded into Genome Graphs, but to have the data
> > plotted in a narrower window than 10,000bp; even 1,000 bp would be an
> > improvement I think for our data, or, optimally, 100bp.  Is this
> > impossible because of computation time, or feasible?
> >
> > Thanks,
> >
> > Bob
> > _________________________________
> > Robert B. Darnell
> > The Rockefeller University
> >
> >
> > _______________________________________________
> > Genome maillist  -  Genome at soe.ucsc.edu
> > http://www.soe.ucsc.edu/mailman/listinfo/genome
> >
>
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome
>

From darnelr at mail.rockefeller.edu  Thu Jan 10 11:36:16 2008
From: darnelr at mail.rockefeller.edu (Robert Darnell)
Date: Thu, 10 Jan 2008 14:36:16 -0500
Subject: [Genome] Fwd:  Genome graph window size
References: <B3DE3210-0D04-4027-BD13-4AB8808FA318@rockefeller.edu>
Message-ID: <EA25ACF2-C5FE-4C2A-805D-981009E3CB50@rockefeller.edu>

Hi Galt:

Thanks for the help.  I sent the email below back to Hiram, from which  
you can see I am in dire straits.

Your solution looks interesting...and makes me wonder if I am  
inputting my data in the wrong format?  When I try loading the file  
format the way you suggested I get errors loading through custom  
tracks (Error File 'test2.txt' - Error line 2 of custom track:  
chromStart after chromEnd (100000000 > 200)), and importing directly  
into Genome Graph it seems to load but is lost (to me)...

Bob
_________________________________
Robert B. Darnell
The Rockefeller University


Begin forwarded message:

> From: Robert Darnell <darnelr at rockefeller.edu>
> Date: January 10, 2008 2:21:30 PM EST
> To: Hiram Clawson <hiram at soe.ucsc.edu>
> Subject: Re: [Genome] Genome graph window size
>
> Hi Hiram:
>
> Thanks very much for the help.  I am going to try your wiggle idea.   
> In the meantime, can I ask an even more basic question about Genome  
> Graph.  The BED files I am plotting look great, but I realize the Y  
> axis doesn't bear any relationship to the data that I can figure  
> out.  So, I made a few test files, which only serve to convince me  
> further I have no idea what I am plotting on Y:
> track name='test data' description='test data'
> chr10 101168028 101168069 4.88
> chr10 101230425 101230508 7.23
> chr9 10000000010000010025
>
>
> and
>
> track name='test data' description='test data'
> chr9 100000000	100000100	200
>
>
> I do understand that the Y axis is plotting 1/3 and 2/3 of  
> something, but it seems to be a fraction of the number 0.01, not of  
> my data...
>
> Thanks for the hand-holding!
>
> Bob
> _________________________________
> Robert B. Darnell
> The Rockefeller University
>
>
> On Jan 10, 2008, at 1:46 PM, Hiram Clawson wrote:
>
>> Good Morning Robert:
>>
>> If your data can be calculated to a consistent window size,
>> say one data point for every 100bp, you can use the
>> wiggle format to view the data in the genome browser:
>> http://genome.ucsc.edu/goldenPath/help/wiggle.html
>>
>> The genome graphs are whole genome viewpoints and wouldn't
>> be able to show your data detail below a couple 100 thousand
>> bases.  Unless you view them in the genome browser, where
>> you could instead view them as wiggle data plots.
>>
>> Wiggle data points are bar graphs at the specified
>> locations with the bars of size "span".  (span must
>> be consistent)  Whereas, the genome graph data
>> points are points on a line graph.  They are different
>> types of graphs.  The wiggle data can be fudged into
>> looking like a line graph by setting the graph
>> options to "points" (actually the lines of the tops
>> of the bars) and set smoothing on to smear those little
>> line segments into a continuous looking line.
>>
>> --Hiram
>>
>> Robert Darnell wrote:
>>> Hi:
>>> I'm a molecular biologist (so have mercy please) interested in  
>>> trying  to graph BED files uploaded into Genome Graphs, but to  
>>> have the data  plotted in a narrower window than 10,000bp; even  
>>> 1,000 bp would be an  improvement I think for our data, or,  
>>> optimally, 100bp.  Is this  impossible because of computation  
>>> time, or feasible?
>>> Thanks,
>>> Bob
>>> _________________________________
>>> Robert B. Darnell
>>> The Rockefeller University
>>> _______________________________________________
>>> Genome maillist  -  Genome at soe.ucsc.edu
>>> http://www.soe.ucsc.edu/mailman/listinfo/genome
>>
>


From galt at soe.ucsc.edu  Thu Jan 10 12:14:53 2008
From: galt at soe.ucsc.edu (Galt Barber)
Date: Thu, 10 Jan 2008 12:14:53 -0800 (PST)
Subject: [Genome] Fwd:  Genome graph window size
In-Reply-To: <EA25ACF2-C5FE-4C2A-805D-981009E3CB50@rockefeller.edu>
References: <B3DE3210-0D04-4027-BD13-4AB8808FA318@rockefeller.edu>
	<EA25ACF2-C5FE-4C2A-805D-981009E3CB50@rockefeller.edu>
Message-ID: <Pine.GSO.4.58.0801101209380.19708@sundance.cse.ucsc.edu>


Put your input data in a local file or make it accessible via URL.

In Genome Graphs,
after clicking upload and selecting your input, give it
at least a name for the data set.
Click submit.
If you see no errors,
You should be returned to the main Genome Graphs view.

Look in the drop down list for the name you gave your
dataset and select that.  It should render your graph.
This is considered a Genome-Graphs custom track,
and it's not the same as a regular custom track.
(Although a regular custom track could be imported
into Genome Graphs, it would be done with 10,000 bp windowing.)

When you click on your genome graph, it should jump
to a genome-browser view of the same region, and from
there you can continue to zoom etc.

-Galt


On Thu, 10 Jan 2008, Robert Darnell wrote:

> Hi Galt:
>
> Thanks for the help.  I sent the email below back to Hiram, from which
> you can see I am in dire straits.
>
> Your solution looks interesting...and makes me wonder if I am
> inputting my data in the wrong format?  When I try loading the file
> format the way you suggested I get errors loading through custom
> tracks (Error File 'test2.txt' - Error line 2 of custom track:
> chromStart after chromEnd (100000000 > 200)), and importing directly
> into Genome Graph it seems to load but is lost (to me)...
>
> Bob
> _________________________________
> Robert B. Darnell
> The Rockefeller University
>
>
> Begin forwarded message:
>
> > From: Robert Darnell <darnelr at rockefeller.edu>
> > Date: January 10, 2008 2:21:30 PM EST
> > To: Hiram Clawson <hiram at soe.ucsc.edu>
> > Subject: Re: [Genome] Genome graph window size
> >
> > Hi Hiram:
> >
> > Thanks very much for the help.  I am going to try your wiggle idea.
> > In the meantime, can I ask an even more basic question about Genome
> > Graph.  The BED files I am plotting look great, but I realize the Y
> > axis doesn't bear any relationship to the data that I can figure
> > out.  So, I made a few test files, which only serve to convince me
> > further I have no idea what I am plotting on Y:
> > track name='test data' description='test data'
> > chr10 101168028 101168069 4.88
> > chr10 101230425 101230508 7.23
> > chr9 10000000010000010025
> >
> >
> > and
> >
> > track name='test data' description='test data'
> > chr9 100000000	100000100	200
> >
> >
> > I do understand that the Y axis is plotting 1/3 and 2/3 of
> > something, but it seems to be a fraction of the number 0.01, not of
> > my data...
> >
> > Thanks for the hand-holding!
> >
> > Bob
> > _________________________________
> > Robert B. Darnell
> > The Rockefeller University
> >
> >
> > On Jan 10, 2008, at 1:46 PM, Hiram Clawson wrote:
> >
> >> Good Morning Robert:
> >>
> >> If your data can be calculated to a consistent window size,
> >> say one data point for every 100bp, you can use the
> >> wiggle format to view the data in the genome browser:
> >> http://genome.ucsc.edu/goldenPath/help/wiggle.html
> >>
> >> The genome graphs are whole genome viewpoints and wouldn't
> >> be able to show your data detail below a couple 100 thousand
> >> bases.  Unless you view them in the genome browser, where
> >> you could instead view them as wiggle data plots.
> >>
> >> Wiggle data points are bar graphs at the specified
> >> locations with the bars of size "span".  (span must
> >> be consistent)  Whereas, the genome graph data
> >> points are points on a line graph.  They are different
> >> types of graphs.  The wiggle data can be fudged into
> >> looking like a line graph by setting the graph
> >> options to "points" (actually the lines of the tops
> >> of the bars) and set smoothing on to smear those little
> >> line segments into a continuous looking line.
> >>
> >> --Hiram
> >>
> >> Robert Darnell wrote:
> >>> Hi:
> >>> I'm a molecular biologist (so have mercy please) interested in
> >>> trying  to graph BED files uploaded into Genome Graphs, but to
> >>> have the data  plotted in a narrower window than 10,000bp; even
> >>> 1,000 bp would be an  improvement I think for our data, or,
> >>> optimally, 100bp.  Is this  impossible because of computation
> >>> time, or feasible?
> >>> Thanks,
> >>> Bob
> >>> _________________________________
> >>> Robert B. Darnell
> >>> The Rockefeller University
> >>> _______________________________________________
> >>> Genome maillist  -  Genome at soe.ucsc.edu
> >>> http://www.soe.ucsc.edu/mailman/listinfo/genome
> >>
> >
>
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome
>

From biomail at gmail.com  Thu Jan 10 14:16:09 2008
From: biomail at gmail.com (qi wang)
Date: Thu, 10 Jan 2008 16:16:09 -0600
Subject: [Genome] Is there a 3-way primates whole genome MAF (hg18, panTro2,
	rheMac2) in UCSC ftp?
Message-ID: <98a149f00801101416y607f066dxcf8361d4fad5b39d@mail.gmail.com>

Hello,

I am now needing a set of primates specific multialignment data. From your
ftp server, I can only find the 28-way or 17-way results. Can you tell me
where can I got the Human-Chimp-Macaque multiz results?

Thank you.
Qi Wang

From kayla at soe.ucsc.edu  Thu Jan 10 14:33:12 2008
From: kayla at soe.ucsc.edu (Kayla Smith)
Date: Thu, 10 Jan 2008 14:33:12 -0800
Subject: [Genome] Batch extraction
In-Reply-To: <C3ABDAE0.DE87%Mike.Mitchell@cancer.org.uk>
References: <C3ABDAE0.DE87%Mike.Mitchell@cancer.org.uk>
Message-ID: <47869D28.90107@cse.ucsc.edu>


Hello Mitchell,

The "define regions" option is working correctly.  If you are retrieving 
refGenes, there is not information about which part of the defined 
regions each refGene is in.

What you can do is to make a Custom Track of your regions then intersect 
that with refGene using the Table Browser.   Here are instructions for 
making a Custom Track:
http://genome.ucsc.edu/goldenPath/help/customTrack.html

Finally, if that doesn't give you a detailed enough intersection, let me 
recommend that you use the Galaxy tool:
http://main.g2.bx.psu.edu/

I hope this information is helpful to you.  Please don't hesitate to 
contact us again if you require further assistance.

Kayla Smith
UCSC Genome Bioinformatics Group

Mike Mitchell wrote:
> Hello!,
> 
> I have a list of 90+ regions for which I would would like to extract data
> from the TableBrowser.
> 
> If I upload these regions into the "define regions" interface the data I get
> back doesn't (seem to) identify which region any particular RefGene is
> within.
> 
> I could c&p each region into the tablebrowser and do the 90+ searches in
> turn, but that will be laborious (and no doubt prone to human error.) Is
> there a way to do a "batch" TableBrowser query? Or is there a better tool I
> could use?
> 
> Thanks in advance for your time and help.
> 


From sselvar1 at asu.edu  Thu Jan 10 14:50:34 2008
From: sselvar1 at asu.edu (SiddarthGautham Selvaraj)
Date: Thu, 10 Jan 2008 15:50:34 -0700
Subject: [Genome] Canonical and Non-Canonical table
Message-ID: <5c826dfc0801101450k4dac79dcs17190e973b7aa6db@mail.gmail.com>

Hi

I am siddarth, graduate student in Arizona State University. I got the
following query.

Many HGNC genes have records in the Knowngene table but not in
KnownCanonical table. I have attached a file that contains gene symbols that
do not have an entry in KnownCanonical but has lot of entries in the
Knowngene table.

How to arise conclusions from it? How does UCSC define genes as canonical
and non canonical. (i.e) When does a gene gains entry in to a
KnownCanonical table from Knowngene table?

Thanks
siddarth

On 09/01/2008, SiddarthGautham Selvaraj <sselvar1 at asu.edu> wrote:
>
> Ya I only mistook them as junk. Pardon me.
>
> Thanks
> siddarth
>
> On 09/01/2008, Brooke Rhead < rhead at soe.ucsc.edu > wrote:
> >
> > Hello again Siddarth,
> >
> > A colleague has pointed out that the names like MARCH1 and C10orf10 are
> > indeed approved gene symbols in HUGO/HGNC.
> >
> > If you look them up at http://www.genenames.org/ you will see entries
> > for them:
> >
> > MARCH1 = membrane-associated ring finger (C3HC4) 1
> > C10orf10 = chromosome 10 open reading frame 10
> >
> > --
> > Brooke Rhead
> > UCSC Genome Bioinformatics Group
> >
> >
> > Brooke Rhead wrote:
> > > Hi Siddarth,
> > >
> > > Pardon me, I did not see the names like 'C10orf10' in my original
> > search
> > > of kgXref.  I see them now.
> > >
> > > When there is a HGNC (HUGO) Gene Symbol available, it will appear in
> > > this field of this table: kgXref.geneSymbol.  Not all genes in the
> > > knownGene table have a HGNC Gene Symbol assigned.
> > >
> > > There is another table in the 'proteome' database that contains HUGO
> > > gene symbols and HGNC IDs: 'hgncXref'.
> > >
> > > One of our team members has developed a MySQL database query that will
> >
> > > retrieve the HGNC gene symbols mapped to the knownGene transcript
> > name:
> > >
> > > SELECT geneSymbol,transcript
> > > FROM knownCanonical,kgXref,proteome.hgncXref
> > > WHERE kgXref.kgID=knownCanonical.transcript
> > > AND kgXref.geneSymbol = proteome.hgncXref.symbol
> > >
> > > Also, here are some previously answered questions that pertain to
> > > getting HUGO gene names from our tables:
> > >
> > > http://www.soe.ucsc.edu/pipermail/genome/2006-April/010350.html
> > > https://www.soe.ucsc.edu/pipermail/genome/2006-September/011570.html
> > >
> > > I hope this information is helpful.
> > >
> >
>
>
-------------- next part --------------
An embedded and charset-unspecified text was scrubbed...
Name: HGNC_non_canonical.txt
Url: http://www.soe.ucsc.edu/pipermail/genome/attachments/20080110/4a700a21/attachment-0001.txt 

From kayla at soe.ucsc.edu  Thu Jan 10 17:10:38 2008
From: kayla at soe.ucsc.edu (Kayla Smith)
Date: Thu, 10 Jan 2008 17:10:38 -0800
Subject: [Genome] Is there a 3-way primates whole genome MAF (hg18,
 panTro2, rheMac2) in UCSC ftp?
In-Reply-To: <98a149f00801101416y607f066dxcf8361d4fad5b39d@mail.gmail.com>
References: <98a149f00801101416y607f066dxcf8361d4fad5b39d@mail.gmail.com>
Message-ID: <4786C20E.4060205@cse.ucsc.edu>


Hello Qi Wang,

Here are two previously answered mailing list questions similar to yours.

http://www.soe.ucsc.edu/pipermail/genome/2006-March/009989.html
http://www.soe.ucsc.edu/pipermail/genome/2007-July/014207.html

I hope this information is helpful to you. Please don't hesitate to 
contact us again if you require further assistance.

Kayla Smith
UCSC Genome Bioinformatics Group



q wang wrote:
> Hello,
> 
> I am now needing a set of primates specific multialignment data. From your
> ftp server, I can only find the 28-way or 17-way results. Can you tell me
> where can I got the Human-Chimp-Macaque multiz results?
> 
> Thank you.
> Qi Wang
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome


From kayla at soe.ucsc.edu  Thu Jan 10 17:12:40 2008
From: kayla at soe.ucsc.edu (Kayla Smith)
Date: Thu, 10 Jan 2008 17:12:40 -0800
Subject: [Genome] go term level
In-Reply-To: <5c2c43620801100743k317b00d8wf61d84f7cca739dc@mail.gmail.com>
References: <5c2c43620801100743k317b00d8wf61d84f7cca739dc@mail.gmail.com>
Message-ID: <4786C288.7090704@cse.ucsc.edu>


Hello Pete,

If I understand correctly, you're looking to retrieve data in the form 
of a gene and its highest level ontology.

There are three main term_types in the term table, as shown in this query:

mysql> SELECT DISTINCT term_type, COUNT(*) AS number FROM term GROUP BY 
term_type;
+-----------------------+--------+
| term_type             | number |
+-----------------------+--------+
| association_qualifier |      4 |
| biological_process    |  12905 |
| cellular_component    |   1977 |
| gene_ontology         |      1 |
| molecular_function    |   8050 |
| relationship          |      1 |
| sequence              |      5 |
| subset                |      5 |
| synonym_type          |      5 |
| universal             |      1 |
+-----------------------+--------+

Notice that the main term_types are:  biological_process, 
cellular_component and molecular_function.

Now, let's use your example:

mysql> select * from goaPart where dbObjectId like "O00139";
+------------+----------------+-------+------------+--------+
| dbObjectId | dbObjectSymbol | notId | goId       | aspect |
+------------+----------------+-------+------------+--------+
| O00139     | KIF2A_HUMAN    |       | GO:0000166 | F      |
| O00139     | KIF2A_HUMAN    |       | GO:0003774 | F      |
| O00139     | KIF2A_HUMAN    |       | GO:0003777 | F      |
| O00139     | KIF2A_HUMAN    |       | GO:0005524 | F      |
| O00139     | KIF2A_HUMAN    |       | GO:0005856 | C      |
| O00139     | KIF2A_HUMAN    |       | GO:0005874 | C      |
| O00139     | KIF2A_HUMAN    |       | GO:0005875 | C      |
| O00139     | KIF2A_HUMAN    |       | GO:0007018 | P      |
+------------+----------------+-------+------------+--------+
8 rows in set (0.01 sec)

The goaPart.aspect column is just symbols representing the 3 main 
term_types above.

F = Molecular Function
C = Cellular Component
P = Biological Process

You can see that the gene you are interested in is part of all three of 
the goaPart.aspect values.

Note that in the data you pasted in your email, you already have this 
information displayed.

I hope this information is helpful to you.  If I misunderstood your 
question, or you require further assistance, please don't hesitate to 
contact us again.

Kayla Smith
UCSC Genome Bioinformatics Group


Pete Shepard wrote:
> Good Morning Browser Folks,
> 
> I am using the Table Browser to extract GO terms for a number of genes from
> go.goaPart table and joining this with the go.term field. I am hoping to get
> the level of each term in the ontology. For example, if I enter a single
> Trembleid=dbObjectId (O00139) I get the following output for the cellular
> component ontology:
> 
> #go.goaPart.dbObjectId	go.goaPart.dbObjectSymbol	go.goaPart.aspect	go.term.name	go.term.term_type	go.term.acc
> O00139	KIF2A_HUMAN	C	cytoskeleton	cellular_component	GO:0005856
> O00139	KIF2A_HUMAN	C	microtubule	cellular_component	GO:0005874
> O00139	KIF2A_HUMAN	C	microtubule associated
> complex	cellular_component	GO:0005875
> 
> 
> 
> I am hoping to get the term at the highest level for each ontology. Is
> there a way to accomplish this such as a number associated with each
> term.
> 
> Thank you.
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome


From kayla at soe.ucsc.edu  Thu Jan 10 17:18:56 2008
From: kayla at soe.ucsc.edu (Kayla Smith)
Date: Thu, 10 Jan 2008 17:18:56 -0800
Subject: [Genome] Canonical and Non-Canonical table
In-Reply-To: <5c826dfc0801101450k4dac79dcs17190e973b7aa6db@mail.gmail.com>
References: <5c826dfc0801101450k4dac79dcs17190e973b7aa6db@mail.gmail.com>
Message-ID: <4786C400.9010203@cse.ucsc.edu>


Hello Siddarth,

Here is a previously answered mailinglist question similar to yours:
https://www.soe.ucsc.edu/pipermail/genome/2005-July/008123.html

I hope this answers your question.

Kayla Smith
UCSC Genome Bioinformatics Group

SiddarthGautham Selvaraj wrote:
> Hi
> 
> I am siddarth, graduate student in Arizona State University. I got the
> following query.
> 
> Many HGNC genes have records in the Knowngene table but not in
> KnownCanonical table. I have attached a file that contains gene symbols that
> do not have an entry in KnownCanonical but has lot of entries in the
> Knowngene table.
> 
> How to arise conclusions from it? How does UCSC define genes as canonical
> and non canonical. (i.e) When does a gene gains entry in to a
> KnownCanonical table from Knowngene table?
> 
> Thanks
> siddarth
> 
> On 09/01/2008, SiddarthGautham Selvaraj <sselvar1 at asu.edu> wrote:
>> Ya I only mistook them as junk. Pardon me.
>>
>> Thanks
>> siddarth
>>
>> On 09/01/2008, Brooke Rhead < rhead at soe.ucsc.edu > wrote:
>>> Hello again Siddarth,
>>>
>>> A colleague has pointed out that the names like MARCH1 and C10orf10 are
>>> indeed approved gene symbols in HUGO/HGNC.
>>>
>>> If you look them up at http://www.genenames.org/ you will see entries
>>> for them:
>>>
>>> MARCH1 = membrane-associated ring finger (C3HC4) 1
>>> C10orf10 = chromosome 10 open reading frame 10
>>>
>>> --
>>> Brooke Rhead
>>> UCSC Genome Bioinformatics Group
>>>
>>>
>>> Brooke Rhead wrote:
>>>> Hi Siddarth,
>>>>
>>>> Pardon me, I did not see the names like 'C10orf10' in my original
>>> search
>>>> of kgXref.  I see them now.
>>>>
>>>> When there is a HGNC (HUGO) Gene Symbol available, it will appear in
>>>> this field of this table: kgXref.geneSymbol.  Not all genes in the
>>>> knownGene table have a HGNC Gene Symbol assigned.
>>>>
>>>> There is another table in the 'proteome' database that contains HUGO
>>>> gene symbols and HGNC IDs: 'hgncXref'.
>>>>
>>>> One of our team members has developed a MySQL database query that will
>>>> retrieve the HGNC gene symbols mapped to the knownGene transcript
>>> name:
>>>> SELECT geneSymbol,transcript
>>>> FROM knownCanonical,kgXref,proteome.hgncXref
>>>> WHERE kgXref.kgID=knownCanonical.transcript
>>>> AND kgXref.geneSymbol = proteome.hgncXref.symbol
>>>>
>>>> Also, here are some previously answered questions that pertain to
>>>> getting HUGO gene names from our tables:
>>>>
>>>> http://www.soe.ucsc.edu/pipermail/genome/2006-April/010350.html
>>>> https://www.soe.ucsc.edu/pipermail/genome/2006-September/011570.html
>>>>
>>>> I hope this information is helpful.

From arhan at ucla.edu  Thu Jan 10 16:37:54 2008
From: arhan at ucla.edu (Areum Han)
Date: Thu, 10 Jan 2008 16:37:54 -0800
Subject: [Genome] download of ucsc known genes
Message-ID: <002f01c853ea$34a0b860$8a2743a4@AreumHan>

Hi. the ucsc known genes table is downloadable in the table browser?

I downloaded knowngene table from table bowser but it does not have below exon, which is visible in genome browser. 

 

>exon_mm8

TTGACCCATTGATCGATGATTACTCTGGAAGTGGAGgcaaat



Sincerely yours,

Areum Han.


From kayla at soe.ucsc.edu  Thu Jan 10 17:29:41 2008
From: kayla at soe.ucsc.edu (Kayla Smith)
Date: Thu, 10 Jan 2008 17:29:41 -0800
Subject: [Genome] download of ucsc known genes
In-Reply-To: <002f01c853ea$34a0b860$8a2743a4@AreumHan>
References: <002f01c853ea$34a0b860$8a2743a4@AreumHan>
Message-ID: <4786C685.3080407@cse.ucsc.edu>


Hello Areum,

Yes, the knownGene table is downloadable here:
http://hgdownload.cse.ucsc.edu/goldenPath/mm8/database/knownGene.txt.gz

The mm8.knownGene table does not contain sequence data, so I'm not sure 
how you are searching.   If you want to find more information about the 
sequence you've pasted, you could try BLATing it.  Click on "BLAT" on 
the blue bar on the top of the main page.

I hope this helps.

Kayla Smith
UCSC Genome Bioinformatics Group



Areum Han wrote:
> Hi. the ucsc known genes table is downloadable in the table browser?
> 
> I downloaded knowngene table from table bowser but it does not have below exon, which is visible in genome browser. 
> 
>  
> 
>> exon_mm8
> 
> TTGACCCATTGATCGATGATTACTCTGGAAGTGGAGgcaaat
> 
> 
> 
> Sincerely yours,
> 
> Areum Han.
> 
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome


From J.Bowes at manchester.ac.uk  Fri Jan 11 06:35:52 2008
From: J.Bowes at manchester.ac.uk (John Bowes)
Date: Fri, 11 Jan 2008 14:35:52 +0000
Subject: [Genome] Gene Ontology
Message-ID: <20080111143552531.00000003328@d6lt192j>

Hello,

I have spent a number of hours trying (unsuccessfully) to extract GO data from for particular gene ids. My aim is to supply a list of gene ids, e.g. PTPN22, and extract the three GO aspects (biological_process, cellular_component and molecular_function). I have tried a number of times, but do not get useful data (either no data, or a large volume of multiple entries). I am sure this due to me not fully understanding the table relationships. I have looked at related questions in the archives but could not implement them.

One example would be PTPN22, this has two molecular_function and three biological_processes when GO is searched manually. But I can't reproduce this through the UCSC browser. Any help would be greatly appreciated.

You are doing a great job with this browser.

Thank you.

John Bowes 



From fanhsu at soe.ucsc.edu  Fri Jan 11 08:29:30 2008
From: fanhsu at soe.ucsc.edu (Fan Hsu)
Date: Fri, 11 Jan 2008 08:29:30 -0800
Subject: [Genome] Gene Ontology
In-Reply-To: <20080111143552531.00000003328@d6lt192j>
References: <20080111143552531.00000003328@d6lt192j>
Message-ID: <003201c8546f$257951f0$6b00a8c0@duo4t>

Hi John,

The GO annotation is dynamically retrieved and displayed on the UCSC Genes
details page.  Attached please find an abbreviated version of the C code
doing this.

If you are not familiar with C, just look at the SQL query which should give
you pretty good idea how we did it using the goaPart table in our go
database.

Fan.
static void goPrint(struct section *section, 
        struct sqlConnection *conn, char *geneId)
/* Print out GO annotations. */
{
struct sqlConnection *goConn = sqlConnect("go");

char query[512];
struct sqlResult *sr;
char **row;
static char *aspects[3] = {"F", "P", "C"};
static char *aspectNames[3] = {
    "Molecular Function",
    "Biological Process",
    "Cellular Component",
};
int aspectIx;

for (aspectIx = 0; aspectIx < ArraySize(aspects); ++aspectIx)
    {
    boolean hasFirst = FALSE;

    safef(query, sizeof(query),
              "select term.acc,term.name"
              " from goaPart,term"
              " where goaPart.dbObjectId = '%s'"
              " and goaPart.goId = term.acc"
              " and goaPart.aspect = '%s'"
              , acc, aspects[aspectIx]);
    sr = sqlGetResult(goConn, query);
    while ((row = sqlNextRow(sr)) != NULL)
        {
        char *goID = row[0];
        char *goTermName = row[1];
        if (!hasFirst)
            {
            hPrintf("<B>%s:</B><BR>", aspectNames[aspectIx]);
            hasFirst = TRUE;
            }
        hPrintf("<A HREF = \"");
 
hPrintf("http://amigo.geneontology.org/cgi-bin/amigo/go.cgi?view=details&sea
rch_constraint=terms&depth=0&query=%s", goID);
        hPrintf("\" TARGET=_blank>%s</A> %s<BR>\n", goID, goTermName);
        }
    if (hasFirst)
        hPrintf("<BR>");
    sqlFreeResult(&sr);
    }
sqlDisconnect(&goConn);
}

-----Original Message-----
From: genome-bounces at soe.ucsc.edu [mailto:genome-bounces at soe.ucsc.edu] On
Behalf Of John Bowes
Sent: Friday, 11 January, 2008 6:36 AM
To: genome at soe.ucsc.edu
Subject: [Genome] Gene Ontology

Hello,

I have spent a number of hours trying (unsuccessfully) to extract GO data
from for particular gene ids. My aim is to supply a list of gene ids, e.g.
PTPN22, and extract the three GO aspects (biological_process,
cellular_component and molecular_function). I have tried a number of times,
but do not get useful data (either no data, or a large volume of multiple
entries). I am sure this due to me not fully understanding the table
relationships. I have looked at related questions in the archives but could
not implement them.

One example would be PTPN22, this has two molecular_function and three
biological_processes when GO is searched manually. But I can't reproduce
this through the UCSC browser. Any help would be greatly appreciated.

You are doing a great job with this browser.

Thank you.

John Bowes 


_______________________________________________
Genome maillist  -  Genome at soe.ucsc.edu
http://www.soe.ucsc.edu/mailman/listinfo/genome


From peter.shepard at gmail.com  Fri Jan 11 08:36:12 2008
From: peter.shepard at gmail.com (Pete Shepard)
Date: Fri, 11 Jan 2008 08:36:12 -0800
Subject: [Genome] Gene Ontology
In-Reply-To: <20080111143552531.00000003328@d6lt192j>
References: <20080111143552531.00000003328@d6lt192j>
Message-ID: <5c2c43620801110836q66d46a6dxb3385d713eab0ea4@mail.gmail.com>

Hi John,

I can try to field this one while you wait for the experts because I have
been working on this exact problem.

You first need to convert your gene id to what I think is a uniprot/tremble
id. Then you can go to the table browser group:  and select all tables, then
from database: select "go"and go.goaPart as the table:. Paste the
uniprot/tremble id into the identifiers (names/accessions): field. Select
"selected fields from primary and related tables" from the output format:
field and hit get output. Now scroll down to linked tables and select "go"
then scroll all the way down and hit "allow selection from checked tables"
select check "name", "term type", and "acc" from the go.term field and then
h
it get output. Below is what I get for your gene. One thing that I cannot
find  is  a way to get the  hierarchical levels of these terms if you find
this out please let me know.

Peter


#go.goaPart.dbObjectId	go.goaPart.dbObjectSymbol	go.term.name	go.term.term_type	go.term.acc
Q9Y2R2	PTN22_HUMAN	phosphoprotein phosphatase
activity	molecular_function	GO:0004721
Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase
activity	molecular_function	GO:0004725
Q9Y2R2	PTN22_HUMAN	protein amino acid
dephosphorylation	biological_process	GO:0006470
Q9Y2R2	PTN22_HUMAN	signal transduction	biological_process	GO:0007165
Q9Y2R2	PTN22_HUMAN	development	biological_process	GO:0007275
Q9Y2R2	PTN22_HUMAN	hydrolase activity	molecular_function	GO:0016787






On Jan 11, 2008 6:35 AM, John Bowes <J.Bowes at manchester.ac.uk> wrote:

> Hello,
>
> I have spent a number of hours trying (unsuccessfully) to extract GO data
> from for particular gene ids. My aim is to supply a list of gene ids, e.g.
> PTPN22, and extract the three GO aspects (biological_process,
> cellular_component and molecular_function). I have tried a number of times,
> but do not get useful data (either no data, or a large volume of multiple
> entries). I am sure this due to me not fully understanding the table
> relationships. I have looked at related questions in the archives but could
> not implement them.
>
> One example would be PTPN22, this has two molecular_function and three
> biological_processes when GO is searched manually. But I can't reproduce
> this through the UCSC browser. Any help would be greatly appreciated.
>
> You are doing a great job with this browser.
>
> Thank you.
>
> John Bowes
>
>
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome
>

From anton.kratz at googlemail.com  Fri Jan 11 02:11:24 2008
From: anton.kratz at googlemail.com (Anton Kratz)
Date: Fri, 11 Jan 2008 19:11:24 +0900
Subject: [Genome] knownToPfam, DNA-coordinates of domains
Message-ID: <68c7994b0801110211p67e2befeq456b0ba990f2308f@mail.gmail.com>

Dear UCSC team,

Context of my question: I am trying to get protein domain coordinates in DNA
space for the domains listed in the knownToPfam table.
Basically what my program does is for each name-value-pair of the
knownToPfam table, it looks up (in the knownGenes table) the protein encoded
by that isoform, then it looks up (in Pfam-A.full, a flatfile with the
entire Pfam database) that domain's sequence and aligns that sequence back
onto the human genome, using BLAT (locally) in translated mode.

My problem is that for 13,636 of the 35,789 name-value-pairs in the
knownToPfam table, I do not find the protein coded for by the respective
isoform when searching for the protein in Pfam-A.full.

Example: according to knownToPfam, NM_015658 contains the domain PF03715.
According to the knownGene table, NM_015658 encodes the protein YU20_HUMAN.
So I am looking for YU20_HUMAN under the entry for PF03715 in Pfam-A.full.
But it's not there and thus not part of the multiple alignment.

I would be very thankful if you have an idea what's going wrong in this
approach.

regards,
Anton

P.S.: Everything I am using is for hg17 because I have other mappings only
available for hg17 which are not available for hg18.

From fanhsu at soe.ucsc.edu  Fri Jan 11 09:06:16 2008
From: fanhsu at soe.ucsc.edu (Fan Hsu)
Date: Fri, 11 Jan 2008 09:06:16 -0800
Subject: [Genome] Gene Ontology
In-Reply-To: <5c2c43620801110836q66d46a6dxb3385d713eab0ea4@mail.gmail.com>
References: <20080111143552531.00000003328@d6lt192j>
	<5c2c43620801110836q66d46a6dxb3385d713eab0ea4@mail.gmail.com>
Message-ID: <003701c85474$475fcf60$6b00a8c0@duo4t>

Thanks to Pete pointing out that acc is the UniProt accession, which you can
bet from the hg18.kgXref table.

To figure out hierarchy, you need to do a little bit of your own
programming/processing.  The parent/child info I believe is contained in the
term2term table of the go database.

Fan.
-----Original Message-----
From: genome-bounces at soe.ucsc.edu [mailto:genome-bounces at soe.ucsc.edu] On
Behalf Of Pete Shepard
Sent: Friday, 11 January, 2008 8:36 AM
To: J.Bowes at manchester.ac.uk
Cc: genome at soe.ucsc.edu
Subject: Re: [Genome] Gene Ontology

Hi John,

I can try to field this one while you wait for the experts because I have
been working on this exact problem.

You first need to convert your gene id to what I think is a uniprot/tremble
id. Then you can go to the table browser group:  and select all tables, then
from database: select "go"and go.goaPart as the table:. Paste the
uniprot/tremble id into the identifiers (names/accessions): field. Select
"selected fields from primary and related tables" from the output format:
field and hit get output. Now scroll down to linked tables and select "go"
then scroll all the way down and hit "allow selection from checked tables"
select check "name", "term type", and "acc" from the go.term field and then
h
it get output. Below is what I get for your gene. One thing that I cannot
find  is  a way to get the  hierarchical levels of these terms if you find
this out please let me know.

Peter


#go.goaPart.dbObjectId	go.goaPart.dbObjectSymbol	go.term.name
go.term.term_type	go.term.acc
Q9Y2R2	PTN22_HUMAN	phosphoprotein phosphatase
activity	molecular_function	GO:0004721
Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase
activity	molecular_function	GO:0004725
Q9Y2R2	PTN22_HUMAN	protein amino acid
dephosphorylation	biological_process	GO:0006470
Q9Y2R2	PTN22_HUMAN	signal transduction	biological_process
GO:0007165
Q9Y2R2	PTN22_HUMAN	development	biological_process	GO:0007275
Q9Y2R2	PTN22_HUMAN	hydrolase activity	molecular_function
GO:0016787






On Jan 11, 2008 6:35 AM, John Bowes <J.Bowes at manchester.ac.uk> wrote:

> Hello,
>
> I have spent a number of hours trying (unsuccessfully) to extract GO data
> from for particular gene ids. My aim is to supply a list of gene ids, e.g.
> PTPN22, and extract the three GO aspects (biological_process,
> cellular_component and molecular_function). I have tried a number of
times,
> but do not get useful data (either no data, or a large volume of multiple
> entries). I am sure this due to me not fully understanding the table
> relationships. I have looked at related questions in the archives but
could
> not implement them.
>
> One example would be PTPN22, this has two molecular_function and three
> biological_processes when GO is searched manually. But I can't reproduce
> this through the UCSC browser. Any help would be greatly appreciated.
>
> You are doing a great job with this browser.
>
> Thank you.
>
> John Bowes
>
>
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome
>
_______________________________________________
Genome maillist  -  Genome at soe.ucsc.edu
http://www.soe.ucsc.edu/mailman/listinfo/genome


From bob at drive5.com  Fri Jan 11 10:34:45 2008
From: bob at drive5.com (Robert Edgar)
Date: Fri, 11 Jan 2008 10:34:45 -0800
Subject: [Genome] CpG islands feature is exon
Message-ID: <CB5C451BB6124CC186351177C50FC472@big>

When I download the "CpG Islands" track in GTF format, the feature field in
the GTF records is "exon". Is this the intent, or am I getting the wrong
records somehow?
Thanks for your help.
Robert Edgar.



From ann at soe.ucsc.edu  Fri Jan 11 11:12:19 2008
From: ann at soe.ucsc.edu (Ann Zweig)
Date: Fri, 11 Jan 2008 11:12:19 -0800
Subject: [Genome] CpG islands feature is exon
In-Reply-To: <CB5C451BB6124CC186351177C50FC472@big>
References: <CB5C451BB6124CC186351177C50FC472@big>
Message-ID: <4787BF93.10901@cse.ucsc.edu>

Hello Robert,

	It does seem a little surprising that the third column of the GTF file 
is "exon".  However, the data in the file is correct.  You can think of 
that field as filler (it had to place some feature name in there, so it 
chose exon).  Read more about the GTF (and GFF) file formats here:
http://genome.ucsc.edu/FAQ/FAQformat#format3


Regards,

----------
Ann Zweig
UCSC Genome Bioinformatics Group
http://genome.ucsc.edu

Please feel free to search the Genome mailing list archives by visiting 
our home page, clicking on "Contact Us", then typing a word or phrase 
into the search box.  On that same page 
(http://genome.ucsc.edu/contacts.html), you can subscribe to the Genome 
mailing list.


Robert Edgar wrote:
> When I download the "CpG Islands" track in GTF format, the feature field in
> the GTF records is "exon". Is this the intent, or am I getting the wrong
> records somehow?
> Thanks for your help.
> Robert Edgar.
> 
> 
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome

From li11 at niehs.nih.gov  Fri Jan 11 11:31:55 2008
From: li11 at niehs.nih.gov (Li, Jianying (NIH/NIEHS) [C])
Date: Fri, 11 Jan 2008 14:31:55 -0500
Subject: [Genome] Difference in nucleotide counts
In-Reply-To: <CB5C451BB6124CC186351177C50FC472@big>
References: <CB5C451BB6124CC186351177C50FC472@big>
Message-ID: <7930EE6CD7CA354D93B444D0433C0611051549ED@NIHCESMLBX6.nih.gov>

Dear admin,

I am currently working on a project and need to get the total count of
nucleotides of human hg-17. After I finished the counting, I compared
with the statistics listed on the genome browser's page:
http://genome.ucsc.edu/goldenPath/stats.html#hg17 

Chr	Assembled Size	Sequenced		I counted
1	247249719		224999719		245522847
2	242951149		237712649		243018229
3	199501827		194704827		199505740
4	191273063		187297063		191411218
5	180857866		177702766		180857866
6	170899992		167273992		170975699
7	158821424		154952424		158628139
8	146274826		142612826		146274826
9	140273252		120143252		138429268
10	135374737		131624737		135413628
11	134452384		131130853		134452384
12	132349534		130303534		132449811
13	114142980		95559980		114142980
14	106368585		88290585		106368585
15	100338915		81341915		100338915
16	88827254		78884754		88827254
17	78774742		77800220		78774742
18	76117153		74656155		76117153
19	63811651		55785651		63811651
20	62435964		59505253		62435964
21	46944323		34171998		46944323
22	49691432		34851332		49554710
X	154913754		151058754		154824264
Y	57772954		25652954		57701691
M	16571			16571			16571
Total   3080436051	2858034764		3076798458

Among these chromosomes, some match but some don't. Could you please
help me explain why? 

Your any attention is appreciated.

Jianying Li




From ann at soe.ucsc.edu  Fri Jan 11 11:35:58 2008
From: ann at soe.ucsc.edu (Ann Zweig)
Date: Fri, 11 Jan 2008 11:35:58 -0800
Subject: [Genome] Difference in nucleotide counts
In-Reply-To: <7930EE6CD7CA354D93B444D0433C0611051549ED@NIHCESMLBX6.nih.gov>
References: <CB5C451BB6124CC186351177C50FC472@big>
	<7930EE6CD7CA354D93B444D0433C0611051549ED@NIHCESMLBX6.nih.gov>
Message-ID: <4787C51E.70502@cse.ucsc.edu>

Hello Jianying Li,

	Looks like some of the stats you are looking at are coming from the 
hg18 assembly, and some from the hg17 assembly.

Regards,

----------
Ann Zweig
UCSC Genome Bioinformatics Group
http://genome.ucsc.edu



Li, Jianying (NIH/NIEHS) [C] wrote:
> Dear admin,
> 
> I am currently working on a project and need to get the total count of
> nucleotides of human hg-17. After I finished the counting, I compared
> with the statistics listed on the genome browser's page:
> http://genome.ucsc.edu/goldenPath/stats.html#hg17 
> 
> Chr	Assembled Size	Sequenced		I counted
> 1	247249719		224999719		245522847
> 2	242951149		237712649		243018229
> 3	199501827		194704827		199505740
> 4	191273063		187297063		191411218
> 5	180857866		177702766		180857866
> 6	170899992		167273992		170975699
> 7	158821424		154952424		158628139
> 8	146274826		142612826		146274826
> 9	140273252		120143252		138429268
> 10	135374737		131624737		135413628
> 11	134452384		131130853		134452384
> 12	132349534		130303534		132449811
> 13	114142980		95559980		114142980
> 14	106368585		88290585		106368585
> 15	100338915		81341915		100338915
> 16	88827254		78884754		88827254
> 17	78774742		77800220		78774742
> 18	76117153		74656155		76117153
> 19	63811651		55785651		63811651
> 20	62435964		59505253		62435964
> 21	46944323		34171998		46944323
> 22	49691432		34851332		49554710
> X	154913754		151058754		154824264
> Y	57772954		25652954		57701691
> M	16571			16571			16571
> Total   3080436051	2858034764		3076798458
> 
> Among these chromosomes, some match but some don't. Could you please
> help me explain why? 
> 
> Your any attention is appreciated.
> 
> Jianying Li
> 
> 
> 
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome

From ann at soe.ucsc.edu  Fri Jan 11 12:01:57 2008
From: ann at soe.ucsc.edu (Ann Zweig)
Date: Fri, 11 Jan 2008 12:01:57 -0800
Subject: [Genome] knownToPfam, DNA-coordinates of domains
In-Reply-To: <68c7994b0801110211p67e2befeq456b0ba990f2308f@mail.gmail.com>
References: <68c7994b0801110211p67e2befeq456b0ba990f2308f@mail.gmail.com>
Message-ID: <4787CB35.6020104@cse.ucsc.edu>

Hello Anton,

	In general your approach seems sound.  My guess is that what's going on 
is that the databases are out-of-sync with the actual data at pfam. 
Note that the hg17.knownToPfam table was built on 2005-07-14.  And that 
hg18 Known Gene track was based on UniProt around 2007-02-02.

	I realize that you are using hg17 because you have annotations and 
mappings in that coordinate system.  You might consider lifting those 
over to hg18 (using our liftOver tool) and then using hg18 and its more 
recent association with pfam.

	As for your specific example, when you look up YU20_HUMAN in UniProt 
you see the following:

	query: YU20_HUMAN

	The ID: YU20_HUMAN is no longer valid.

	YU20_HUMAN (associated with primary accession number: Q9Y3T9 from 
release 39.10) was renamed to NOC2L_HUMAN in release 47.8.

	And the following queries of hg17 and hg18 show:

mysql> select kgId,spDisplayID from hg17.knownToPfam, hg17.kgXref where
value='PF03715' and kgId=name;
+-----------+--------------+
| kgId      | spDisplayID  |
+-----------+--------------+
| AK022756  | Q9H9J5_HUMAN |
| AK092491  | Q8NAK7_HUMAN |
| NM_015658 | YU20_HUMAN   |
| BC003555  | Q9H9J5_HUMAN |
+-----------+--------------+


mysql> select kgId,spDisplayID from hg18.knownToPfam, hg18.kgXref where
value='PF03715' and kgId=name;
+------------+--------------+
| kgId       | spDisplayID  |
+------------+--------------+
| uc001aby.1 | Q9H9J5_HUMAN |
+------------+--------------+

mysql> select  * from hg18.knownToPfam where value='PF03715';
+------------+---------+
| name       | value   |
+------------+---------+
| uc001aby.1 | PF03715 |
+------------+---------+


	I hope this is helpful to you.

Regards,

----------
Ann Zweig
UCSC Genome Bioinformatics Group
http://genome.ucsc.edu



Anton Kratz wrote:
> Dear UCSC team,
> 
> Context of my question: I am trying to get protein domain coordinates in DNA
> space for the domains listed in the knownToPfam table.
> Basically what my program does is for each name-value-pair of the
> knownToPfam table, it looks up (in the knownGenes table) the protein encoded
> by that isoform, then it looks up (in Pfam-A.full, a flatfile with the
> entire Pfam database) that domain's sequence and aligns that sequence back
> onto the human genome, using BLAT (locally) in translated mode.
> 
> My problem is that for 13,636 of the 35,789 name-value-pairs in the
> knownToPfam table, I do not find the protein coded for by the respective
> isoform when searching for the protein in Pfam-A.full.
> 
> Example: according to knownToPfam, NM_015658 contains the domain PF03715.
> According to the knownGene table, NM_015658 encodes the protein YU20_HUMAN.
> So I am looking for YU20_HUMAN under the entry for PF03715 in Pfam-A.full.
> But it's not there and thus not part of the multiple alignment.
> 
> I would be very thankful if you have an idea what's going wrong in this
> approach.
> 
> regards,
> Anton
> 
> P.S.: Everything I am using is for hg17 because I have other mappings only
> available for hg17 which are not available for hg18.
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome

From eherman at ucla.edu  Fri Jan 11 15:22:16 2008
From: eherman at ucla.edu (Edward Herman)
Date: Fri, 11 Jan 2008 15:22:16 -0800
Subject: [Genome] GeneSorter References
Message-ID: <df2fded90801111522r31417a1cxad7f88be26421193@mail.gmail.com>

Hi,
We have recently used the Gene Sorter tool on our gene of interest, and
found a striking overlap between the list that this tool generated and our
own data.  We would like to know more about what publications or results the
Gene Sorter is based on and how we can access them.  In particular, we are
interested in the HRPD Protein-Protein interaction database.  We tried their
website (www.hprd.org) searching on our gene and clicking the "Interactions"
tab, but only a subset (8 out of 71) appear here with links to publications.

Can you tell us more about what data was used to generate the HRPD
Protein-Protein interaction database on the Gene Sorter tool?

Thanks,
Eddie
Geschwind Lab, UCLA

From fanhsu at soe.ucsc.edu  Fri Jan 11 15:39:35 2008
From: fanhsu at soe.ucsc.edu (Fan Hsu)
Date: Fri, 11 Jan 2008 15:39:35 -0800
Subject: [Genome] GeneSorter References
In-Reply-To: <df2fded90801111522r31417a1cxad7f88be26421193@mail.gmail.com>
References: <df2fded90801111522r31417a1cxad7f88be26421193@mail.gmail.com>
Message-ID: <005301c854ab$39a6c270$6b00a8c0@duo4t>

Hi Eddie,

Attached below please find the detailed processing steps we used to 
build our knownToHprd table.  Help this helps.

Fan.

BUILD HPRD DATA FOR KNOWN GENE DETAILS PAGE LINKS (DONE 9/11/06)

# Download HPRD_XML_060106.tar.gz from www.hprd.org

    gzip -d HPRD_XML_060106.tar.gz
    tar -xvf HPRD_XML_060106.tar.gz

# This will create 18838 xxxx.xml files under HPRD_XML_060106

# Create hprdToCdna table

    echo 'grep -H entry_cdna  HPRD_XML_060106/$1.xml' >do1Cdna

    ls  HPRD_XML_060106 >j
    cat j |sed -e 's/.xml/\tdo1Cdna/g' >jj
    cut -f 1 jj >j.2
    cut -f 2 jj >j.1
    paste j.1 j.2 >doAllCdna
    chmod +x do*

    ./doAllCdna >j.cdna
    cat j.cdna| sed -e 's/\//\t/' | sed -e 's/.xml/\t/' |\
    sed -e 's/<entry_cdna>/\t/' | sed -e 's/<\//\t/'| sed -e 's/\./\t/'| cut
-f 2,4|\
    grep -v None >hprdToCdna.tab

    hgsql hg18 -e 'drop table hprdToCdna'
    hgsql hg18 <~/src/hg/lib/hprdToCdna.sql
    hgsql hg18 -e 'load data local infile "hprdToCdna.tab" into table
hprdToCdna'

# Create hprdToUniProt table

    echo 'fgrep -H Swiss  HPRD_XML_060106/$1.xml' >do1

    ls HPRD_XML_060106 >j
    cat j |sed -e 's/.xml/\tdo1/g' >jj
    cut -f 1 jj >j.2
    cut -f 2 jj >j.1
    paste j.1 j.2 >doall
    chmod +x do*

    ./doall >j.out
    cat j.out|grep SwissProt | sed -e 's/\//\t/' | sed -e 's/.xml/\t/' | \
    sed -e 's/Prot>/\t/' | sed -e 's/<\//\t/'| cut -f 2,4|grep -v None
>hgrdToUniProt.tab

    hgsql hg18 -e 'drop table hprdToUniProt'
    hgsql hg18 <~/src/hg/lib/hprdToUniProt.sql
    hgsql hg18 -e 'load data local infile "hprdToUniProt.tab" into table
hprdToUniProt'

# build knownToHprd table

    hgsql hg18 -N -e 'select kgId,hprdId from hprdToCdna, kgXref where
cdnaId=kgId' >j.kg1
    hgsql hg18 -N -e 'select kgId,hprdId from hprdToUniProt, kgXref where
uniProtId=spId' >j.kg2

    cat j.kg1 j.kg2 |sort -u >knownToHprd.tab
    wc knownToHprd.tab

    hgsql hg18 -e 'drop table knownToHprd'
    hgsql hg18 <~/src/hg/lib/knownToHprd.sql

    hgsql hg18 -e 'load data local infile "knownToHprd.tab" into table
knownToHprd'
    hgsql hg18 -e 'select count(*) from knownToHprd'

# 19,646 records created.

# remove temporary files.

    rm j*

-----Original Message-----
From: genome-bounces at soe.ucsc.edu [mailto:genome-bounces at soe.ucsc.edu] On
Behalf Of Edward Herman
Sent: Friday, 11 January, 2008 3:22 PM
To: genome at soe.ucsc.edu
Cc: Brett Abrahams
Subject: [Genome] GeneSorter References

Hi,
We have recently used the Gene Sorter tool on our gene of interest, and
found a striking overlap between the list that this tool generated and our
own data.  We would like to know more about w