[Genome] sequence discrepancy

[Robert Kuhn]

Steve,

It is not clear to me where you get the value for the PCR
on the transcripts.  When I use your primers on the rat assembly,
I also get a  region of 429 bases (in gene GJA1).  When I click into 
the details page of the mRNA that aligns at this location (e.g., X06656),
I see that the mRNA is a perfect match to the reference assembly
for the entire 429 bases.  Could you please explain where you are
seeing the extra 70 bases? 

best wishes,

			--b0b kuhn
			ucsc genome bioinformatics group


> From genome at soe.ucsc.edu  Fri Feb  1 09:07:18 2008
> Subject: [Genome] sequence discrepancy
> 
> Dear All:
> 
> I have found a rat gene (GAJ1) where electronic PCR on the UCSC browser 
> yields a product length (with the primers i've chosen) of 429 bases.  
> PCR from the cDNA/mRNA yields a predicted length of 498.  i have not 
> yet done the PCR to see what the truth is, but i assume it  will be 
> 498.
> 
> primers in question are:
> 
>   CTGCGAAAACGTCTGCTATG
>   GGACGTGAGAGGAAGCAGTC
> 
> 
> its really not that important, but i wondered if you (pl) would have 
> insight into what happened to the ~70 bases??
> 
> thanks
> 
> steve brown
> University of Vermont
> 
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome