[Genome] sequence discrepancy

[Stephen Brown]

Dear All:

I have found a rat gene (GAJ1) where electronic PCR on the UCSC browser 
yields a product length (with the primers i've chosen) of 429 bases.  
PCR from the cDNA/mRNA yields a predicted length of 498.  i have not 
yet done the PCR to see what the truth is, but i assume it  will be 
498.

primers in question are:

  CTGCGAAAACGTCTGCTATG
  GGACGTGAGAGGAAGCAGTC


its really not that important, but i wondered if you (pl) would have 
insight into what happened to the ~70 bases??

thanks

steve brown
University of Vermont