[Genome] RP11-85P8

Archana Thakkapallayil archanat at soe.ucsc.edu
Tue Sep 4 13:33:39 PDT 2007


Hello Dominique,

Sorry for the delay in responding to your question. We are examining the 
issue to restore the clone to the fishClones track.  In the meantime, to 
locate RP11-85P8 on hg18, take the hg17 sequence:

 >hg17_RP11-85P8
TCACTAAATAGCTGAAAAATTTACATATTATTTTAAAACATAGACTTAAA
AAATCATATTAGCTTCTCCTTAGCAAAATGCTTTTGTTTTATGTATTTAC
AAGAATATACTGTACTTCAGGTACACAATTCACTCAAGCCAGCCTGAGAA
GGCCTTGGATGCAGATCAATGCTCCAATAAAGTTCATTATCAGCTCCTCC
TGCCTTGTGACAGGATGATTTGATTTTACAAAAGTCCCTTTGAAAACAAG
AGTAAACGCAGACAGCTTCTAGAGAAAAGTCTGGTGAAGCAGCAGTTGAT
AATAGATTTTCTTTTAGTGATGAAATTAATCTTGTTTTGGTAATCTACAG
CCTGTTAGGGATAGGTGGAGGGATGAAGTCCTTAAAACTAAATTGTTCCT

And blat that to hg18, to find the location: chr13:27475789-27476188, 
which can also be found on hg18 as the STS Marker RH1828.

I hope that this helps. If you have further questions please don't 
hesitate to contact us.

Regards,
Archana.

Archana Thakkapallayil wrote:
> Hello Dominique,
>
> Our developers are looking into this issue and it may take a few days. I 
> will get back to you when I have more information.
>
> Regards,
>
> Archana
> UCSC Genome Bioinformatics Group
>
> Dominique Muehlematter wrote:
>   
>> Sir, At the beginning of the year, I was interested to perform FISH
>> experiments in 13q12 region and consequently I looked for BACs in USCS
>> database and ordered them to BACPAC Resources. One of these BACs is
>> RP11-85P8 (found with UCSC Genome Browser v149). Now I am unable to
>> relocalize it in 13q12. Do you know what happens ? Thank you in advance
>> for your response. Yours sincerly. D. Mühlematter
>> Dr. Dominique Mühlematter Unité de cytogénétique du cancer
>> Service de génétique médicale CHUV 1011 Lausanne, Suisse
>> tel.    41'21'314'33'82 Fax   41'21'314'34'44
>> email : Dominique.Muhlematter at chuv.ch
>>
>>
>> _______________________________________________
>> Genome maillist  -  Genome at soe.ucsc.edu
>> http://www.soe.ucsc.edu/mailman/listinfo/genome
>>   
>>     
>
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome
>   



More information about the Genome mailing list