[Genome] RP11-85P8

[Archana Thakkapallayil]

Hello Dominique,

Sorry for the delay in responding to your question. We are examining the 
issue to restore the clone to the fishClones track.  In the meantime, to 
locate RP11-85P8 on hg18, take the hg17 sequence:

 >hg17_RP11-85P8
TCACTAAATAGCTGAAAAATTTACATATTATTTTAAAACATAGACTTAAA
AAATCATATTAGCTTCTCCTTAGCAAAATGCTTTTGTTTTATGTATTTAC
AAGAATATACTGTACTTCAGGTACACAATTCACTCAAGCCAGCCTGAGAA
GGCCTTGGATGCAGATCAATGCTCCAATAAAGTTCATTATCAGCTCCTCC
TGCCTTGTGACAGGATGATTTGATTTTACAAAAGTCCCTTTGAAAACAAG
AGTAAACGCAGACAGCTTCTAGAGAAAAGTCTGGTGAAGCAGCAGTTGAT
AATAGATTTTCTTTTAGTGATGAAATTAATCTTGTTTTGGTAATCTACAG
CCTGTTAGGGATAGGTGGAGGGATGAAGTCCTTAAAACTAAATTGTTCCT

And blat that to hg18, to find the location: chr13:27475789-27476188, 
which can also be found on hg18 as the STS Marker RH1828.

I hope that this helps. If you have further questions please don't 
hesitate to contact us.

Regards,
Archana.

Archana Thakkapallayil wrote:
> Hello Dominique,
>
> Our developers are looking into this issue and it may take a few days. I 
> will get back to you when I have more information.
>
> Regards,
>
> Archana
> UCSC Genome Bioinformatics Group
>
> Dominique Muehlematter wrote:
>   
>> Sir, At the beginning of the year, I was interested to perform FISH
>> experiments in 13q12 region and consequently I looked for BACs in USCS
>> database and ordered them to BACPAC Resources. One of these BACs is
>> RP11-85P8 (found with UCSC Genome Browser v149). Now I am unable to
>> relocalize it in 13q12. Do you know what happens ? Thank you in advance
>> for your response. Yours sincerly. D. Mühlematter
>> Dr. Dominique Mühlematter Unité de cytogénétique du cancer
>> Service de génétique médicale CHUV 1011 Lausanne, Suisse
>> tel.    41'21'314'33'82 Fax   41'21'314'34'44
>> email : Dominique.Muhlematter at chuv.ch
>>
>>
>> _______________________________________________
>> Genome maillist  -  Genome at soe.ucsc.edu
>> http://www.soe.ucsc.edu/mailman/listinfo/genome
>>   
>>     
>
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome
>