[Genome] FW: snp not found

Vasta, Valeria Valeria.Vasta at seattlechildrens.org
Thu Oct 18 09:30:44 PDT 2007


Hello  a snp that was listed as rs9526822 in genome browser was labeled
differently at Entrez (rs7321120). Could you please tell mewhy is that?
Thanks

Valeria
-----Original Message-----
From: Pechous, Steve (NIH/NLM/NCBI) [C]
[mailto:pechous at ncbi.nlm.nih.gov] 
Sent: Monday, September 24, 2007 2:08 PM
To: Vasta, Valeria
Subject: RE: snp not found

Hi Valeria,

	That position on Chr 13 corresponds to rs7321120
(http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?type=rs&rs=7321120)

	You can see that this is found within an intron. Although many
disease-causing mutations are annotated in the SNP records (usually the
coding - nonsynonymous SNPs color-coded red) your best confirmation is
from the OMIM record for the gene of interest. Select View List under
the Allelic Variants section linked to on the left blue links bar
(http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=606882)

The OMIM records are the most comprehensive set of mutational data.

Regards,
 
Steve Pechous, Ph. D.
NCBI User Services

-----Original Message-----
From: Vasta, Valeria [mailto:Valeria.Vasta at seattlechildrens.org] 
Sent: Monday, September 24, 2007 4:48 PM
To: Pechous, Steve (NIH/NLM/NCBI) [C]
Subject: RE: snp not found

It is within ATP7B chr 13:51482779    TGAAACCTAAAGATTTCTCTGAATGTGTGCAT

I found it through Blat

also is ther any info on whether a SNP is also a mutation (causing a
disease) 
would that be found in the snp info somewhere?

-----Original Message-----
From: Pechous, Steve (NIH/NLM/NCBI) [C]
[mailto:pechous at ncbi.nlm.nih.gov] 
Sent: Monday, September 24, 2007 1:34 PM
To: Vasta, Valeria
Subject: re: snp not found

Dear Colleague,

	Do you have more information than the snp ID? We have a new SNP
build and there could be changes. For example, do you have the
gene/locus of the SNP and it's position?

Regards,
 
Steve Pechous, Ph. D.
NCBI User Services

------------- Begin Forwarded Message -------------

Delivered-To: info at ncbi.nlm.nih.gov
From: valeria.vasta at seattlechildrens.org
To: info at ncbi.nlm.nih.gov
Subject: snp not found
Date: Mon, 24 Sep 2007 14:00:49 -0400 (EDT)

Name: valeria vasta
Date and Time: Monday, September 24, 2007 11:00:36 AM
Database: nucleotide
SessionId: 263E1C346F7E2E60_0057SID
Host: portal104
Snapshot: entrez
Browser's user agent header: Mozilla/4.0 (compatible; MSIE 6.0; Windows
NT 5.1; 
SV1; .NET CLR 1.1.4322; .NET CLR 2.0.50727; .NET CLR 3.0.04506.30)
Page: Results

Message Body: I got this infor for a snp 
dbSNP build 126 rs9526822

but when I search the snp site with rs9526822 it doesn't show up?

also if there's info on whether a SNP is also a mutation (causing a
disease) 
would that be found in the snp info somewhere?
thanks

------------- End Forwarded Message -------------




CONFIDENTIALITY NOTICE:  This e-mail message, including any attachments,
is for the sole use of the intended recipient(s) and may contain
confidential and privileged information protected by law.  Any
unauthorized review, use, disclosure or distribution is prohibited.  If
you are not the intended recipient, please contact the sender by reply
e-mail and destroy all copies of the original message.



CONFIDENTIALITY NOTICE:  This e-mail message, including any attachments, is for the sole use of the intended recipient(s) and may contain confidential and privileged information protected by law.  Any unauthorized review, use, disclosure or distribution is prohibited.  If you are not the intended recipient, please contact the sender by reply e-mail and destroy all copies of the original message.





More information about the Genome mailing list