[Genome] looking for the table containing the exact information of a side by side

[Brooke Rhead]

Hello Xiaolu,

If you are looking for the actual sequence alignments, and not just 
summary information about the alignments, you will need to download the 
pairwise alignment files available on our downloads server, here:
http://hgdownload.cse.ucsc.edu/goldenPath/hg18/vsMm9/
(The chain and net tables do not contain any sequence.)

For a good explanation of how to use the information in the chain and 
net tables, please see this previously answered question:
http://www.soe.ucsc.edu/pipermail/genome/2006-February/009869.html

Regarding your last question, I do not believe the tName (human) and 
qName (mouse) have been reversed in the chainMm9 and chainMm9Link 
tables.  Is there a specific example in the tables that looks incorrect?

--
Brooke Rhead
UCSC Genome Bioinformatics Group


> Subject: looking for the table containing the exact information of a side by side 
> alignment
> From: Xiaolu Huang <xhuang at unmc.edu>
> Date: Wed, 7 Nov 2007 14:11:07 -0600
> To: genome at soe.ucsc.edu
> CC: Katheleen.Gardiner at UCHSC.edu
> 
> Dear bioinformaticians at UCSC,
> 
> I have a side by side alignment and want to calculate the similarity.
> 
> a smaple side by side alignment (net) (query human genome and target is 
> mouse genome) is as follows:
> 
> 87486267 aaacctggagactaggaactagtacagcattggccgtgc-----------tgcagcaatg 
> 87486315
>  >>>>>>>>  ||  || ||| | |||| |||||| | ||      |||           |  |||| |  
>  >>>>>>>>
> 29355972 caaagtgaagaatgggaa-tagtaccgtatcatttttgcatatccacagatatagcacta 
> 29356030
> 
> 87486316 gt-----------cgaccgtccacactctgcaac 87486338
>  >>>>>>>>              | ||   |   ||  | |||  >>>>>>>>
> 29356031 agaactgctttagcaactaacagtacattacaat 29356064
> 
> I have checked the netMm9 table, it does not seem to have the granuality 
> I need (detailed to each base and base pair). Do you have a table that 
> contain the detailed side by side alignment information for mouse and 
> human genome comparison?
> 
> Also for the chainMm9 and chainMm9Link tables, is the target name and 
> query name have been reversed?
> 
> Thanks!
> 
> Xiaolu Huang
>