[Genome] Not the same assemblies in the browser and in the downloadable sequence files ?

[Brooke Rhead]

Hello Herve,

I tried downloading the dm2 fasta sequence located at:

http://hgdownload.cse.ucsc.edu/goldenPath/dm2/bigZips/chromFa.zip

I unzipped the chromFa.zip file and looked at chrX.fa.  The first line 
of that file looks consistent with the sequence in the Browser:

 >chrX
tagagcaaaaaatagacattttaatggcgctaatcatacaaggaaggaat

Which is not the same as what you are seeing.  As far as I can tell, 
everything is correct on our download site.  I suggest that you
make a new empty directory and re-download and unzip the chromFa.zip
file there.  If you still see the incorrect sequence, please let us know.

--
Brooke Rhead
UCSC Genome Bioinformatics Group



Herve Seitz wrote:
> Dear developers,
> 
> I noticed a difference between the genomic sequences for Drosophila  
> melanogaster chromosome X on the browser and in the sequence file  
> that I downloaded from http://hgdownload.cse.ucsc.edu/goldenPath/dm2/ 
> bigZips/ :
> according to the browser, the first 30 nucleotides of melanogaster  
> chromosome X are: TAGAGCAAAAAATAGACATTTTAATGGCGC (cf http:// 
> genome.ucsc.edu/cgi-bin/hgTracks? 
> hgsid=87534567&hgt.dummyEnterButton.x=0&hgt.dummyEnterButton.y=0&clade=i 
> nsect&org=D.+melanogaster&db=dm2&position=chrX% 
> 3A1-30&pix=620&hgsid=87534567 )
> but according to chrX.fa (in the archive chromFa.zip, downloaded from  
> http://hgdownload.cse.ucsc.edu/goldenPath/dm2/bigZips/ ), the first  
> 30 nucleotides of that chromosome are: CAACATTAGCGCCATGCCCACTGTGGGGAA.
> 
> When I search this sequence in the "browser" version of the  
> chromosome (with BLAT), I can see that it starts on bp 6547 of  
> chromosome X; reciprocally, when I look for  
> TAGAGCAAAAAATAGACATTTTAATGGCGC in chrX.fa, I find it on the 164th  
> line of the file (hence, at position ~8100).
> 
> So it seems that the downloadable sequence for D. melanogaster  
> chromosome X, and the browser version, do not result from the same  
> assembly. Is is possible to download the "browser" version of the  
> assembly ? It seems that chromosome X is not the only one - chr2R  
> also differs between the downloadable file and the browser version ;  
> the beginning of chr2L seems to be identical in both versions, but  
> the total length is different: 22,407,834 bp according to the  
> browser, and 23,471,775 in chr2L.fa.
> 
> Thanks in advance,
> 
> 		Hervé
> 
> --
> Hervé Seitz, PhD
> Department of Biochemistry and Molecular Pharmacology
> University of Massachusetts Medical School
> Lazare Research Building, Room 870P
> 364 Plantation Street
> Worcester, MA 01605-2324
> USA
> telephone: (508) 856 1220
> 
> 
> 
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome