[Genome] question about BLAT

[Jasmin Roohi]

Hello UCSC Genome Browser:

I've got 2 sequences. Sequence 1 is 90bp long. Sequence 2 is 45bp long and
is identical to the last 45 bases of Sequence 1. Why is it that when I BLAT
Sequence 1, I only get 1 hit to the genome but when I BLAT Sequence 2, I get
2.

Here are the sequences.

Sequence 1:
TTTTAAGGTGTAATGTGATATGCTGCAGTTAAGGCACCGTGGTACAGTGAATGAAAGATATGGTGATTCTGAGAAGAGAATCAGAGAAGC

Sequence 2:
AGTGAATGAAAGATATGGTGATTCTGAGAAGAGAATCAGAGAAGC


Thanks for your help.

Best,
Jasmin
-- 

_______________________________
Jasmin Roohi, MSTP V
Stony Brook School of Medicine
and Department of Genetics

Stony Brook University Medical Center
Health Sciences Tower T8-053
Stony Brook, NY 11794-8088
(631) 444-3126
jroohi at gmail.com