[Genome] help interpret PCR results

[Brooke Rhead]

Hello Nallasivam,

This mailing list is generally intended for questions more directly 
related to the Genome Browser.  However, sometimes the community of 
users who subscribe to the mailing list are able to help one another.

If anyone reading the mailing list has any ideas or insight for this 
user, your response is welcome.

--
Brooke Rhead
UCSC Genome Bioinformatics Group



-------- Original Message --------
Date: 	Mon, 5 Mar 2007 09:12:27 +0800
From: 	Nallasivam PALANISAMY <palanisamyn at gis.a-star.edu.sg>
To: 	<genome at soe.ucsc.edu>
CC: 	<genome-mirror at soe.ucsc.edu>, <cbseweb at cbse.ucsc.edu>

I need help to resolve the following seq, which is present only in the 
mRNA of RCC2 gene and in the 5’UTR of FSCN2 gene but not in the genomic 
seq of both genes.

We identified this seq as part of a chimeric gene identified by 5’RACE.

By FISH analysis, we did not find the colocalization of signal with the 
partner gene.

Please help to interpret out PCR results.


Thank you

=================================================================

Our seq:  CGCGGATCCAGACGCTGCGTTTGCTGGCTTTGATGAA

 >NM_018715 (RCC2) length=4114
ttgatgaaacgcggatccagacgctgcgtttgctggctttgatgaaacgcacatgtgttt
ctgttttgtgttgtagcatttgttctggaagctcgtatttacattttaagtgtatctggt
gagtgggctggagccctcgtctgggccggaaaaaaaaaagccctccgatccgtcttttag
ttgcttctcttccttttttctctccggtttctcatcactccaaccagccgcgaccatgcc
caggaagaaggcggcggcggcggcctgggaggagccgagctcgggcaacggcactgcccg
cgccgggcccaggaaacgcggcggcccggcgggcaggaagcgcgagcggcccgagcgctg


Nallasivam Palanisamy, Ph.D.
Group Leader, Cancer Biology
Genome Institute of Singapore
60, Biopolis Street, #02-01 Genome
Singapore, 138672
Tel: (65)  6478 8173 Fax: (65)  6478 9004
email:palanisamyn at gis.a-star.edu.sg

http://www.gis.a-star.edu.sg/internet/site/investigators.php?f=cv&user_id=15

This email is confidential and may be privileged. If you are not the 
intended receipient, please delete it and notify us immediately. Please 
do not copy or use it for any purpose or disclose its contents to any 
other person. Thank you.