[Genome] problem with primers

[Colin Sieff]

If one tries to do in silico PCR with primers that come from a gene  
that is mapped to the reverse strand of the DNA on the UCSC map, then  
the PCR won't work! Here is an example of a gene whose primers were  
selected using an application called Primer Express (ABI). The 5'  
primer will not map to the mouse genome, and only the reverse primer  
will flip. Of course when one does this one does not know which weay  
the gene is encoded, so all this is not very satisfactory. You  
probably know all this. Any comment?
Thanks,
Colin Sieff


ATCGCCGAAGCACAAAACAT

CAATGCGACAGGATAGGGAAC