[Genome] blat vs gfclient

[Brooke Rhead]

Hello Stef,

You are correct, there are several options for the gfServer/gfClient 
program (as well as for the command-line BLAT program).  See the 
specifications for each here:

http://genome.ucsc.edu/goldenPath/help/blatSpec.html

Also, if you are interested in replicating the parameters of our 
web-based BLAT with command-line gfServer/gfClient, see this FAQ:

http://genome.ucsc.edu/FAQ/FAQblat#blat5

I hope these documents answer your questions.  If you have further 
questions, please do not hesitate to write back to this list.

--
Brooke Rhead
UCSC Genome Bioinformatics Group



stef wrote:
> Hi,
> I use the gfServer/gfClient program in local.
> I blat a sequence:
> TTCCTAGGGTTATGCATCTGAAATGGCTTCCCTGGGAACATCTGTCTTTTACTGTTGTAG
> 
> In my server I have just one hit:
> M_19_P435
> 60
> 0
> 60
> 60
> 100
> chr19
> +
> 24227499
> 24227559
> 
> In your server I have 16 hits:
> 
>   ACTIONS      QUERY           SCORE START  END QSIZE IDENTITY CHRO
> STRAND  START    END      SPAN
> ---------------------------------------------------------------------------------------------------
> browser details YourSeq           60     1    60    60 100.0%    19   +   24252500  24252559     60
> browser details YourSeq           44     1    60    60  86.7%     X   +   47849681  47849740     60
> browser details YourSeq           40     1    60    60  83.4%     1   -  230241821 230241880     60
> browser details YourSeq           40     1    60    60  83.4%     1   +  199935838 199935897     60
> browser details YourSeq           34    17    60    60  88.7%    19   +   24247652  24247695     44
> browser details YourSeq           31    17    57    60  87.9%     X   -   12895565  12895605     41
> browser details YourSeq           31    17    59    60  86.1%     X   +  145427137 145427179     43
> browser details YourSeq           30    21    60    60  87.5%     4   -  162321720 162321759     40
> browser details YourSeq           27    17    49    60  91.0%     9   +    5249431   5249463     33
> browser details YourSeq           23    25    53    60  88.0%    10   -   78936679  78936706     28
> browser details YourSeq           22    10    38    60  69.6%     4   -  152980422 152980444     23
> browser details YourSeq           21    20    40    60 100.0%     7   +   91099097  91099117     21
> browser details YourSeq           20    20    39    60 100.0%     X   -   84882537  84882556     20
> browser details YourSeq           20    20    39    60 100.0%     8   -  114706556 114706575     20
> browser details YourSeq           20    20    39    60 100.0%    13   -   78551231  78551250     20
> browser details YourSeq           20    17    36    60 100.0%     X   +  109671326 109671345     20
> 
> 
> Why do I have a difference between the 2 blat ?
> Maybe there is some options ?
> Cause I need to have all the hits.
> best
> Stef Liva
> 
> 
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome