[Genome] Error accessing UCSC gene pages

Kayla Smith kayla at soe.ucsc.edu
Mon Jul 16 17:32:40 PDT 2007


Steve,

One thing I neglected to mention was that a cart reset will make it so 
that your original URL will work.  However, in the scenario you 
describe, a user clicking to the Genome Browser from netaffx may already 
have something in their cart here.  And you would have to reset the cart 
each time.

The way to reset your cart is via this link:
http://genome.ucsc.edu/cgi-bin/cartReset

A developer here has pointed out that you ought to try making your links 
look like this:
http://genome.ucsc.edu/cgi-bin/hgGene?org=Human&hgg_gene=uc004ffn.1

I hope this is helpful to you. Please don't hesitate to contact us again 
if you require further assistance.

Kayla Smith
UCSC Genome Bioinformatics Group

Steve Chervitz wrote:
> Kayla,
> 
> The URL you supplied with the hgg_chrom=none gave me a page consisting of
> only the sequence:
> 
>> uc003znw.1 (RPS6) length=497
> ctgaacatctccttcccagccactggctgccagaaactcattgaagtggacgatgaacgc
> aaacttcgtactttctatgagaagcgtatggccacagaagttgctgctgacgctctgggt
> gaagaatggaagggttatgtggtccgaatcagtggtgggaacgacaaacaaggtttcccc
> atgaagcagggtgtcttgacccatggccgtgtccgcctgctactgagtaaggggcattcc
> tgttacagaccaaggagaactggagaaagaaagagaaaatcagttcgtggttgcattgtg
> gatgcaaatctgagcgttctcaacttggttattgtaaaaaaaggagagaaggatattcct
> ggactgactgatactacagtgcctcgccgcctgggccccaaaagagctagcagaatccgc
> aaacttttcaatctctctaaagaagatgatgtccgccagtatgttgtaagaaagccctta
> aataaagaaggtaggag
> 
> When I re-submitted the query again, with or without the hgg_chrom=none
> parameter, I got the full Description and Page Index, which is what I was
> expecting to get.
> 
> As for where I got the link, I crafted it myself based on a human gene page
> I pulled up from a random genome browser view, and then I used that as a
> template for constructing links for other genes, such as in the present
> example.
> 
> What I'm trying to do is to rig up links to UCSC gene pages from NetAffx web
> pages since we are now including UCSC gene sequences in our assignment
> pipeline (new release is due out tomorrow 7/16).
> 
> I suppose we should include the hgg_chrom=none parameter in the URLs we
> create?
> 
> Steve 
> 
> 
>> From: Kayla Smith <kayla at soe.ucsc.edu>
>> Date: Mon, 16 Jul 2007 16:34:31 -0700
>> To: Steve Chervitz <Steve_Chervitz at affymetrix.com>
>> Cc: "genome at soe.ucsc.edu" <genome at soe.ucsc.edu>
>> Subject: Re: [Genome] Error accessing UCSC gene pages
>>
>>
>> Steve,
>>
>> Try adding &hgg_chrom=none to your url.  Your cart still has old
>> variables in it from the last thing you looked at.
>>
>> This link should work for you:
>>
>> http://genome.ucsc.edu/cgi-bin/hgGene?hgg_type=knownGene&db=hg18&hgg_chrom=non
>> e&hgg_gene=uc
>> 003znw.1
>>
>> Also, may I inquire where you got the problematic link from?
>>
>> I hope this is helpful to you.  Please don't hesitate to contact us
>> again if you require further assistance.
>>
>> Kayla Smith
>> UCSC Genome Bioinformatics Group
>>
>> Steve Chervitz wrote:
>>> I'm getting an 'Early Error' page when attempting to access a URL such as:
>>>
>>> http://genome.ucsc.edu/cgi-bin/hgGene?hgg_type=knownGene&db=hg18&hgg_gene=uc
>>> 003znw.1
>>>
>>> Error message:
>>> Can't find select * from knownGene where name = 'uc003znw.1' and chrom =
>>> 'chr2' and txStart=161873185 and txEnd=161976172
>>>
>>> Am I using the correct URL?
>>>
>>> Thanks,
>>> Steve
>>>
>>> _______________________________________________
>>> Genome maillist  -  Genome at soe.ucsc.edu
>>> http://www.soe.ucsc.edu/mailman/listinfo/genome



More information about the Genome mailing list