[Genome] gfClient maxIntron

[Julien Lagarde]

Hi Galt,
Thanks for your answer.
I'm a bit confused now. If I understand you correctly blat would simply 
forbid non-canonical introns?

Then how come this synthetic cDNA seq:

CAGAGCTCTGCCTGAGATTCTTGGGGCCTGCACAGGAGGGCAGCCCCA
GGATGCCCGCAGGGAATGCCAGCTCTGTGGGGCTGACCTCCAACAGGC
CGTGCACAGATGGTGATGGGGGAGGGAGTGGCTCTCCGGCCCTGACGT
GGCCCCCCGCCTGCCTTTCTGGACACCCCTGCTCTGCCGGCTCAGCAG
CCCCAGCACCCGCTTCTGAGCTCTGGGTTCAAACAGAGATTAATCAGA
GCGTCGCTCAACTGCACCCCAGCCCCAGGACCCGGCCACCATGTTGCA
TCACCGCAGAGCCAAACATCAGGATGCTGCTGGAGGTGACTGTCCCGG
TGCCGGTTCCCCTGTGGAGACCCCCCTGGCTGCTCTCAGCCTCACCCA
ATGCCCTTCTTGGCCCTGCTGGACACAGAGCTGCAGACAGAGATGAAG
GAGACAGCGGTAGCCGCAGGCATTACCCAATGCAACCCCCAGCCCCCG
CCCCTGCCCACGTTGCATCACAGCCGACCCGAGGAGCCGCAGCTCCCA
GAGGAAGACACGGTGGGGCCGATGCAGATGCAGCTGGAGATACAGCCT
GGTCTCCCTCCTCTGGGTCAGGTCTCCGGCGCCCTCCCGCCGGCCTGC
AGGGCTGCATTAGGATGGGGAGTTTGAGCTCAGTTAGAGACCAGCCCC
AGAAACGCAGAGAGAGGGTGCAGCGCCG

is correctly spliced "CAag.(6kb).agAA" by blat?
cheers,
julien


Galt Barber wrote:
> People are using the -maxIntron= successfully.
>
> Looking at the ends of your "exons", they don't look
> like proper intron ends.
>
> AGag agAG
>
> should be
> XXgt agXX
>
> The chainer is trying to chain exons together
> to make a gene model.  It follows splice-junction
> rules.
>
> You could artificially construct one by
> taking an exon from one gene and an exon
> from another gene far enough away, and
> that way the chainer would see proper
> intron ends.
>
> -Galt
>
>
> On Thu, 12 Jul 2007, Julien Lagarde wrote:
>
>   
>> Hi genome,
>>
>> i'm trying to map exons separated by long introns with gfServer/gfClient
>> (v.33) on hg17.
>>
>>
>> unfortunately gfClient seems to ignore whatever maxIntron value i use.
>> Here's an example:
>>
>> gfClient -minScore=0 -minIdentity=0 -nohead -maxIntron=1000000 localhost
>> 3500 / test.seq test.psl
>>
>> test.seq is:
>> AGTCAACCCTTCTGTAAATCACCTGCTGTGGTTATGATGCTCTGAGTTCA
>> ATACGTCTGAACCTTTGCTGTCTATGGATCTGCTCTAAACCTTATAGCCT
>> GCTTATGGGGGAAGAGAAATGGAAAAGAAAATGAAATAAATCAGCAGTTA
>> TGAGGCAGAGCCTAAGAGAACTATGGCAACATCAGGTGACTGTCCCAGAA
>> GTGAATCGCAG
>>
>> and corresponds to two "fake" (i.e. i made them up) exons separated by a
>> 786kb intron.
>>
>> The resulting psl output is:
>> 114     0       0       0       0       0       0       0       +
>> test_long_intron        211     0       114     chr21   46944323
>> 46094323        46094437        1       114,    0,      46094323,
>> 97      0       0       0       0       0       0       0       +
>> test_long_intron        211     114     211     chr21   46944323
>> 46881233        46881330        1       97,     114,    46881233,
>>
>> so basically blat finds the two blocks but does not join them together.
>>
>> What do you think?
>>
>> thanks a lot,
>> julien
>>
>> --
>> -----------------------------------------------------
>> Julien Lagarde
>> Genome Bioinformatics Research Group
>> Centre de Regulacio Genomica
>> Grup de Recerca en Informatica Biomedica (IMIM)
>> Dr. Aiguader, 88 				(+34) 93 3160166 ph
>> E-08003 Barcelona				(+34) 93 3160099 fax
>> http://genome.imim.es
>> --------------------------------
>>
>>
>>
>> --------
>> La informació continguda en aquest missatge i en qualsevol fitxer
>> adjunt és confidencial, privada i d'ús exclusiu per al destinatari.
>> Si no és la persona a la qual anava dirigida aquesta informació, si us
>> plau, notifiqui immediatament l'enviament erroni al remitent i esborri
>> el missatge. Qualsevol còpia, divulgació, distribució o utilització no
>> autoritzada d'aquest correu electrònic i dels seus adjunts està 
>> prohibida en virtut de la legislació vigent.
>>
>> La información contenida en este mensaje y en cualquier fichero
>> adjunto es confidencial, privada y de uso exclusivo para el
>> destinatario. Si usted no es la persona a la cual iba dirigida esta
>> información, por favor, notifique inmediatamente el envío erróneo al
>> remitente y borre el mensaje. Cualquier copia, divulgación,
>> distribución o utilización no autorizada de este correo electrónico y
>> de sus adjuntos está prohibida en virtud de la legislación vigente.
>>
>> The information included in this e-mail and any attached files are
>> confidential and private. If you are not the intended recipient,
>> please notify the error to the sender and delete this message
>> immediately. Dissemination, forwarding or copying of this e-mail and
>> its associated attachments is strictly prohibited according with
>> current legislation.
>> --------
>>
>> _______________________________________________
>> Genome maillist  -  Genome at soe.ucsc.edu
>> http://www.soe.ucsc.edu/mailman/listinfo/genome
>>
>>     
>
>   

-- 
-----------------------------------------------------
Julien Lagarde
Genome Bioinformatics Research Group
Centre de Regulacio Genomica 
Grup de Recerca en Informatica Biomedica (IMIM)
Dr. Aiguader, 88 				(+34) 93 3160166 ph
E-08003 Barcelona				(+34) 93 3160099 fax
http://genome.imim.es
--------------------------------



--------
La informació continguda en aquest missatge i en qualsevol fitxer 
adjunt és confidencial, privada i d'ús exclusiu per al destinatari.
Si no és la persona a la qual anava dirigida aquesta informació, si us 
plau, notifiqui immediatament l'enviament erroni al remitent i esborri 
el missatge. Qualsevol còpia, divulgació, distribució o utilització no 
autoritzada d'aquest correu electrònic i dels seus adjunts està 
prohibida en virtut de la legislació vigent.

La información contenida en este mensaje y en cualquier fichero 
adjunto es confidencial, privada y de uso exclusivo para el 
destinatario. Si usted no es la persona a la cual iba dirigida esta 
información, por favor, notifique inmediatamente el envío erróneo al 
remitente y borre el mensaje. Cualquier copia, divulgación, 
distribución o utilización no autorizada de este correo electrónico y 
de sus adjuntos está prohibida en virtud de la legislación vigente.

The information included in this e-mail and any attached files are 
confidential and private. If you are not the intended recipient, 
please notify the error to the sender and delete this message 
immediately. Dissemination, forwarding or copying of this e-mail and 
its associated attachments is strictly prohibited according with 
current legislation.
--------