[Genome] gfClient maxIntron

[Galt Barber]

People are using the -maxIntron= successfully.

Looking at the ends of your "exons", they don't look
like proper intron ends.

AGag agAG

should be
XXgt agXX

The chainer is trying to chain exons together
to make a gene model.  It follows splice-junction
rules.

You could artificially construct one by
taking an exon from one gene and an exon
from another gene far enough away, and
that way the chainer would see proper
intron ends.

-Galt


On Thu, 12 Jul 2007, Julien Lagarde wrote:

> Hi genome,
>
> i'm trying to map exons separated by long introns with gfServer/gfClient
> (v.33) on hg17.
>
>
> unfortunately gfClient seems to ignore whatever maxIntron value i use.
> Here's an example:
>
> gfClient -minScore=0 -minIdentity=0 -nohead -maxIntron=1000000 localhost
> 3500 / test.seq test.psl
>
> test.seq is:
> AGTCAACCCTTCTGTAAATCACCTGCTGTGGTTATGATGCTCTGAGTTCA
> ATACGTCTGAACCTTTGCTGTCTATGGATCTGCTCTAAACCTTATAGCCT
> GCTTATGGGGGAAGAGAAATGGAAAAGAAAATGAAATAAATCAGCAGTTA
> TGAGGCAGAGCCTAAGAGAACTATGGCAACATCAGGTGACTGTCCCAGAA
> GTGAATCGCAG
>
> and corresponds to two "fake" (i.e. i made them up) exons separated by a
> 786kb intron.
>
> The resulting psl output is:
> 114     0       0       0       0       0       0       0       +
> test_long_intron        211     0       114     chr21   46944323
> 46094323        46094437        1       114,    0,      46094323,
> 97      0       0       0       0       0       0       0       +
> test_long_intron        211     114     211     chr21   46944323
> 46881233        46881330        1       97,     114,    46881233,
>
> so basically blat finds the two blocks but does not join them together.
>
> What do you think?
>
> thanks a lot,
> julien
>
> --
> -----------------------------------------------------
> Julien Lagarde
> Genome Bioinformatics Research Group
> Centre de Regulacio Genomica
> Grup de Recerca en Informatica Biomedica (IMIM)
> Dr. Aiguader, 88 				(+34) 93 3160166 ph
> E-08003 Barcelona				(+34) 93 3160099 fax
> http://genome.imim.es
> --------------------------------
>
>
>
> --------
> La informació continguda en aquest missatge i en qualsevol fitxer
> adjunt és confidencial, privada i d'ús exclusiu per al destinatari.
> Si no és la persona a la qual anava dirigida aquesta informació, si us
> plau, notifiqui immediatament l'enviament erroni al remitent i esborri
> el missatge. Qualsevol còpia, divulgació, distribució o utilització no
> autoritzada d'aquest correu electrònic i dels seus adjunts està 
> prohibida en virtut de la legislació vigent.
>
> La información contenida en este mensaje y en cualquier fichero
> adjunto es confidencial, privada y de uso exclusivo para el
> destinatario. Si usted no es la persona a la cual iba dirigida esta
> información, por favor, notifique inmediatamente el envío erróneo al
> remitente y borre el mensaje. Cualquier copia, divulgación,
> distribución o utilización no autorizada de este correo electrónico y
> de sus adjuntos está prohibida en virtud de la legislación vigente.
>
> The information included in this e-mail and any attached files are
> confidential and private. If you are not the intended recipient,
> please notify the error to the sender and delete this message
> immediately. Dissemination, forwarding or copying of this e-mail and
> its associated attachments is strictly prohibited according with
> current legislation.
> --------
>
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome
>