[Genome] Can I remove a BLAT hit from the genome browser display?

[Brooke Rhead]

Hello Gordon,

You can give a name to your BLAT sequence that will appear in the 
Browser display by giving the sequence a fasta file header, like so:

 >your_name_here
TACATTTCCTATTCAAGGAACATTTTCCTGTAAAATGACAGGTTGAAGAAAACAGCC

However, this is somewhat limited, as the only text that will appear in 
the Browser display is the first word after the ">".  It will not 
display any text after a space (hence the underscores in the example). 
Also, there is no functionality to enter a description like there is 
with custom tracks.

There is a simple way to remove the BLAT hit from view.  Look in the 
"Mapping and Sequencing Tracks" section of the track controls.  You 
should see a drop-down box for "Blat Sequence" at the end of that group, 
where you can set the track to "hide".

I hope this information helps.  Please let us know if you have any 
further questions.

--
Brooke Rhead
UCSC Genome Bioinformatics Group



Gordon Robertson wrote:
> Hello,
> 
> I've just found a genomic location for a ~60bp sequence using BLAT,  
> and checked its location relative to a gene of interest in the  
> browser. Now, I would like to retain the results as a screenshot, and  
> to have informative text associated with the hit in the display. I'd  
> prefer to be able to enter an informative 'name' and 'description'  
> with the BLAT sequence submission, but I'm not aware of this  
> functionality in the browser. Given this, I convert the BLAT hit  
> coordinates into a custom BED track. This is straightforward, but  
> when I then view the custom track in the browser I see both the new  
> custom track and the BLAT hit, and I am not aware of how delete the  
> BLAT hit from the view (I know I can hide or delete a custom track).  
> The view also contains several other custom tracks that I'd loaded  
> previously, which I'd prefer not to have to reload.
> 
> Is there a simple way to remove a specific BLAT hit from a browser view?
> 
> The input sequence:  
> TACATTTCCTATTCAAGGAACATTTTCCTGTAAAATGACAGGTTGAAGAAAACAGCC
> The top BLAT hit on hg17: 57     1    57    57 100.0%     8   +    
> 39889456  39889512     57
> The custom track:
> browser position chr8:39,889,201-39,890,700
> track name='RE' description='BLAT hit...'
> chr8 39889456 39889512
> 
> Thank you for your help.
> 
> G
> --
> Gordon Robertson
> Canada's Michael Smith Genome Sciences Centre
> Vancouver BC Canada
> 
> 
> 
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome