[Genome] Can I remove a BLAT hit from the genome browser display?

[Gordon Robertson]

Hello,

I've just found a genomic location for a ~60bp sequence using BLAT,  
and checked its location relative to a gene of interest in the  
browser. Now, I would like to retain the results as a screenshot, and  
to have informative text associated with the hit in the display. I'd  
prefer to be able to enter an informative 'name' and 'description'  
with the BLAT sequence submission, but I'm not aware of this  
functionality in the browser. Given this, I convert the BLAT hit  
coordinates into a custom BED track. This is straightforward, but  
when I then view the custom track in the browser I see both the new  
custom track and the BLAT hit, and I am not aware of how delete the  
BLAT hit from the view (I know I can hide or delete a custom track).  
The view also contains several other custom tracks that I'd loaded  
previously, which I'd prefer not to have to reload.

Is there a simple way to remove a specific BLAT hit from a browser view?

The input sequence:  
TACATTTCCTATTCAAGGAACATTTTCCTGTAAAATGACAGGTTGAAGAAAACAGCC
The top BLAT hit on hg17: 57     1    57    57 100.0%     8   +    
39889456  39889512     57
The custom track:
browser position chr8:39,889,201-39,890,700
track name='RE' description='BLAT hit...'
chr8 39889456 39889512

Thank you for your help.

G
--
Gordon Robertson
Canada's Michael Smith Genome Sciences Centre
Vancouver BC Canada