[Genome] BLAT output: how to interpret the numbers when the alignment happened on the negative strand? / Can I specify neg. strand counting in command-line version?

[Kayla Smith]

Anton,

The 5' end of this gene would be at the coordinate 2699153 (the second 
of the two coordinates listed).

To convince yourself that this is so, compare the output you get when 
getting the sequence these two ways:  1.  Ask for the sequence of this 
gene from it's known genes details page.   2.  With the gene open in the 
browser, click on the "DNA" button on the blue bar on the top of the 
page.   Doing this shows the gene with reverse complemented DNA compared 
to the reference strand.

Data in our tables may be found on either the positive or negative strand.

Also keep in mind the "off by one" concern when comparing data from 
tables to the data being displayed.  Details are in the FAQ here:  
http://genome.ucsc.edu/FAQ/FAQtracks#tracks1

I hope this helps to answer your question.  Please don't hesitate to 
contact us again if you require more assistance.

Kayla Smith
UCSC Genome Bioinformatics Group


Anton Kratz wrote:
> Thank you very much for this answer. I'd like to ask a question about the
> genomic positions in the UCSC Table Browser. I retrieved a file with
> positions like this:
>
> #hg17.knownToLocusLink.value    hg17.knownGene.name    hg17.knownGene.chrom
> hg17.knownGene.strand    hg17.knownGene.txStart    hg17.knownGene.txEnd
> [...]
> 6736    NM_003140    chrY    -    2698256    2699153
> [..]
>
> NM_003140 is on the negative strand. Does this mean that the gene starts
> from 2698256th position coming from the 5' end or coming from the 3' end?
>
> Are all positions in the Table browser similar to BLAT or are they "mixed"
> depending on the dataset?
>
> Anton
>
> 2007/1/23, Rachel Harte <hartera at soe.ucsc.edu>:
>   
>> Anton,
>>
>> You are correct in saying that the coordinates in the Blat output are
>> relative to the + strand even if the sequence aligns to the - strand.
>> Unfortunately, there isn't an option to get output with coordinates
>> relative to the - strand. You will need to write a script to reformat the
>> Blat output to give - strand coordinates.
>>
>> I hope that this helps you. Please let us know if you have further
>> questions.
>>
>> Rachel
>>
>> Rachel Harte
>> UCSC Genome Bioinformatics Group
>> http://genome.ucsc.edu
>>
>>
>> On Tue, 23 Jan 2007, Anton Kratz wrote:
>>
>>     
>>> Hi,
>>>
>>> I have a question regarding BLAT output, how to interpret the numbers
>>>       
>> when
>>     
>>> the alignment happened on the negative strand.
>>>
>>> Let's say I have the genetic sequence on hg17/NCBI35, Chromosome 3,
>>>       
>> negative
>>     
>>> (!) Strand, starting from 57505108 and going to 57505208 (from 5' to
>>>       
>> 3'):
>>     
>> aaaaaccacaagcatgcctatacaccaatagtagacaaacagagagccaaatcatgagtgaactcccatttacaattgctacaaagagaatgaaatacct
>>     
>>> When I align this with the online BLAT-Version on
>>> http://genome.ucsc.edu/cgi-bin/hgBlat against hg17 I expected to get,
>>>       
>> well,
>>     
>>> something like this as a result:
>>>
>>>    ACTIONS      QUERY           SCORE START  END QSIZE IDENTITY CHRO
>>>       
>> STRAND
>>     
>>> START    END      SPAN
>>>
>>>       
>> ---------------------------------------------------------------------------------------------------
>>     
>>> browser details YourSeq          100     1   100   100 100.0%     3   -
>>> 57505108  57505208   100
>>> [...]
>>>
>>>
>>> But actually the first lines of the results page look like this:
>>>
>>> BLAT Search Results
>>>
>>>    ACTIONS      QUERY           SCORE START  END QSIZE IDENTITY CHRO
>>>       
>> STRAND
>>     
>>> START    END      SPAN
>>>
>>>       
>> ---------------------------------------------------------------------------------------------------
>>     
>>> browser details YourSeq          100     1   100   100 100.0%     3   -
>>> 142000533 142000632    100
>>> [...]
>>>
>>> So my first question is: does BLAT display positions in respect to the
>>> positive strand, even if the alignment was on the negative strand?
>>>
>>> If yes: can I somehow make the command-line version of BLAT display the
>>> positions is the output.psl file in respect to the negative strand?
>>>
>>> Best regards,
>>> Anton
>>> _______________________________________________
>>> Genome maillist  -  Genome at soe.ucsc.edu
>>> http://www.soe.ucsc.edu/mailman/listinfo/genome
>>>
>>>       
>
>
>
>