[Genome] hg18 chr3 strange characters
Jeltje van Baren
jeltje at cse.wustl.edu
Sat Feb 24 08:39:22 PST 2007
Hi Browserians
One of my programs died because of strange characters in hg18 chr3:
[jeltje at ardor chr3]$ grep -n R chr3.fa
1216118:CCRRGCTTGGTTCTAACAATGAATTTAATAAGAATTGTATTTAATCAATG
[jeltje at ardor chr3]$ grep -n M chr3.fa
1216113:TCTTCATTAGCGCTACATAGCTGMCTTATTATTCGTGGTCCCCTATGACC
On the Browser, these are represented as N
I did not check the other chromosomes.
-Jeltje
More information about the Genome
mailing list