[Genome] hg18 chr3 strange characters

Jeltje van Baren jeltje at cse.wustl.edu
Sat Feb 24 08:39:22 PST 2007


Hi Browserians

One of my programs died because of strange characters in hg18 chr3:

[jeltje at ardor chr3]$ grep -n R chr3.fa
1216118:CCRRGCTTGGTTCTAACAATGAATTTAATAAGAATTGTATTTAATCAATG
[jeltje at ardor chr3]$ grep -n M chr3.fa
1216113:TCTTCATTAGCGCTACATAGCTGMCTTATTATTCGTGGTCCCCTATGACC

On the Browser, these are represented as N
I did not check the other chromosomes.

-Jeltje


More information about the Genome mailing list