[Genome] multiz 28 way

[Ann Zweig]

Hello Bart,

	Thanks for bringing this to our attention.  We are looking into it.  I 
will let you know when I have an explanation and/or a fix.

Regards,

----------
Ann Zweig
UCSC Genome Bioinformatics Group
http://genome.ucsc.edu




Bart Hooghe wrote:
> Dear UCSC staff -
> 
> I was wondering how I should interpret the double human records in the 
> 28 way at
> http://hgdownload.cse.ucsc.edu/goldenPath/hg18/multiz28way/maf/upstream5000.maf.gz 
> ?
> I downloaded the multiz 17 way and multiz 28 way a while ago and I am 
> now confronted with the fact that in the 28 way there is a 'species' 
> with name NM_...
> and one with hg18. I assume both point to the human sequence. But why 
> and what's the difference ? This is not the case for multiz 17 way.
> 
> the output of  'grep -A25 "NM_003639" multiz28way_upstream5000.maf | more'
> starts with
> s NM_003639 0 5000 + 5000 ....................................
> and contains only a few hundred bases in the middle of the alignment 
> sequence
> the 14th species in this alignment piece starts with
> s hg18      0 5000 + 5000 CCTGAACTCTTGCTGGTCTGCTTACTTGCCGTGGTTCC-CTGGCCGCAA
> 
> the output of 'grep -A20 "NM_003639" multiz17way_upstream5000.maf | more'
> starts with
> s NM_003639 0 5000 + 5000 
> CCTGAACTCTTGCTGGTCTGCTTACTTGCCGTGGTTCCCTGGCCGCA-ATAGCACATAGG
> 
> Greets,
> Bart
> 
> ---------------------------------------------------------------------------------
> Bart L. Hooghe, predoctoral fellow,
> Bioinformatics Core,
> Department for Molecular Biomedical Research (DMBR)
> VIB - Ghent University
> Fiers-Schell-Van Montagu Research Building
> Technologiepark 927 , B-9052 Zwijnaarde , Belgium
> tel ++32(0)93313693 	fax ++32(0)93313609
> mailto: Bart.Hooghe at dmbr.UGent.be       
> 
> ---------------------------------------------------------------------------------
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome