[Genome] BLATing probe sequences against human genome

[Tim Gernat]

Hi!

I want to use BLAT to align probe sequences from an Affymetrix 
expression array to the human genome. The goal is to find out which 
probes potentially detect RNA originating from multiple genes. Each 
of the probes is described in a file that looks like this ...

Probe Set Name,Probe X,Probe Y,Probe Interrogation Position,Probe 
Sequence,Target Strandedness
1007_s_at,416,177,3330,CACCCAGCTGGTCCTGTGGATGGGA,Antisense
1007_s_at,569,289,3443,GCCCCACTGGACAACACTGATTCCT,Antisense
...

... and the field "Target Strandedness" always says "Antisense".

My question is, how do I set the BLAT parameters -t and -q in order 
to find all genomic loci from which RNA could be produced that can be 
detected by one of the probes? Currently I set the parameters 
to  -t=dna and -q=rna, but I'm new to BLAT and not sure whether this is right.

Thanks in advance for your help!

Regards,
Tim


Tim Gernat
Genome Biology Group, CMLS
Lawrence Livermore National Laboratory
7000 East Avenue, L-441
Livermore, CA 94550