[Genome] Question about no hits by using BLAT

Archana Thakkapallayil archanat at soe.ucsc.edu
Tue Aug 7 14:09:52 PDT 2007


Hello Yu,

I blatted the below sequences to the Human genome and I couldn't get any 
hits either. Here are the possible explanations from one of our developers:

BLAT won't find a hit if the sequences are not really from the genome, 
or if they are from rna-space (i.e. could contains introns that would 
split them into even tinier regions which would be insufficient to 
align). Another explanation is that if the sequences are in repeat 
regions, in which case web-based blat won't necessarily find a hit 
(because we throw out the blat sequence tiles that are over-represented).

Also, one of our developers blasted the first sequence below using this 
online free blast tool:

http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgi?taxid=9606

and it found nothing anywhere.

I hope this information helps. If you have further questions, please 
don't hesitate to contact us.

Regards,

Archana
UCSC Genome Bioinformatics Group

Yu Zhou wrote:
> Hello,
>
> We have hundreds of sequences from sequencing PCR products in experiments.
> We expect that they should be segments of the human genome and could be
> mapped to the genome (with or without mismatches). However, by using web
> BLAT, around 100 of them don't have  any hit. It is very disappointing.
>
> I pasted some of them as below. Whether you can get hits? Could you tell me
> some reasons in those cases? ( I don't know if errors in PCR and sequencing
> could cause so many mutations that the sequences couldn't be mapped to their
> orignal positions in genome.) How to use BLAT or are there other methods, to
> do better mapping? (BLAT is so quick, whether exist slower programs with
> better sensitivity?) Thanks a lot!
>
>   
>> 1
>>     
> TCAGCGTTATCACCATTTGCTGGTCGATGGCTTTAGTTTCCCGGCCATTACCCGCCAGAT
>   
>> 4
>>     
> TACTAGTATCAGCGTTATCACCATTTGCTGGTCGATGGCTTTAGTTTCCCGGCCATTACCCGCCAGAT
>   
>> 11
>>     
> TCGATGGCTTTAGTTTCCCGGCCATTACCCGCCAGAT
>   
>> 18
>>     
> CGGTTCTTCCAGCAGGCTTTCGCTTAAGTCAGCGTTAC
>   
>> 22
>>     
> TACGCCATCACCAAAGATATCTT
>   
>> 38
>>     
> CGCACTGCGTCGCGAACCACGGCTGCGCTTTACGCTAACAGAAGTGAATGATCTACCGGTCCGGCAAA
>
>
>
>   



More information about the Genome mailing list