[Genome] Question about no hits by using BLAT
Yu Zhou
zhouyubio at gmail.com
Tue Aug 7 06:00:46 PDT 2007
Hello,
We have hundreds of sequences from sequencing PCR products in experiments.
We expect that they should be segments of the human genome and could be
mapped to the genome (with or without mismatches). However, by using web
BLAT, around 100 of them don't have any hit. It is very disappointing.
I pasted some of them as below. Whether you can get hits? Could you tell me
some reasons in those cases? ( I don't know if errors in PCR and sequencing
could cause so many mutations that the sequences couldn't be mapped to their
orignal positions in genome.) How to use BLAT or are there other methods, to
do better mapping? (BLAT is so quick, whether exist slower programs with
better sensitivity?) Thanks a lot!
>1
TCAGCGTTATCACCATTTGCTGGTCGATGGCTTTAGTTTCCCGGCCATTACCCGCCAGAT
>4
TACTAGTATCAGCGTTATCACCATTTGCTGGTCGATGGCTTTAGTTTCCCGGCCATTACCCGCCAGAT
>11
TCGATGGCTTTAGTTTCCCGGCCATTACCCGCCAGAT
>18
CGGTTCTTCCAGCAGGCTTTCGCTTAAGTCAGCGTTAC
>22
TACGCCATCACCAAAGATATCTT
>38
CGCACTGCGTCGCGAACCACGGCTGCGCTTTACGCTAACAGAAGTGAATGATCTACCGGTCCGGCAAA
--
Best regards,
Yu Zhou
More information about the Genome
mailing list