[Genome] affy 430 chip

[zentner@salk.edu]

Hi Bob,

Thank you for the e-mail link; I'll use it from now on.

Just to respond to your note...

I am attaching the trimmed version of the download from UCSC on the MOE430
2.0 chip -my regret, and its really the only one I have...

I wish I could get just two more columns added to that text file.  i.e.
the "start" and "end" of the target sequence from which the probes were
designed.  NOT the sequence itself, but the genomic coordinates just like
the "tStart" and "tEND" for the transcript.

The challenge for the bioinformaticist is that the target sequence will
come back from a Blast, in many cases, with many different genomic loci. 
However, if one could filter that query or the post query data by the
chromosomal (tName) and locus (tStart and tEnd) you've already provided
(see attached file) you should arrive at a single target sequence "start"
and "end" coordinate.

Is that possible for me to retrieve from you guys?  Whether or not it is
possible, I must tell you... you guys have done a fantastic job with what
you do provide... I have always found it thoughtfully rendered and
accessible.  You guys do a fantastic job and I think really help to move
genomics forward for the scientists that aren't computer-programming savy.

Mark


> Hello, Mark,
> Sorry I did not respond sooner.  I've been in meetings a lot
> lately and did not check my messages.  In general, the best
> way to get a quick response is to ask our mailng list,
>   genome at soe.ucsc.edu
>   (link on the Contact Us page off the main page)
> The list is monitored constantly.  I believe the 430 chip
> has rather large probes on it.  I downloaded a file from
> this page on their site:
> http://www.affymetrix.com/support/technical/byproduct.affx?product=moe430
on this page, under "Sequences", I used the link,
>   MOE430A  Probe Sequences FASTA (4.4 MB, 11/19/03)
> Here the first few lines of the file:
>>probe:MOE430A:1415670_at:41:537; Interrogation_Position=2436;
> Antisense;
> GGCTGATCACATCCAAAAAGTCATG
>>probe:MOE430A:1415670_at:549:177; Interrogation_Position=2513;
> Antisense;
> GAGGAAACGTTCACCCTGTCTACTA
>>probe:MOE430A:1415670_at:467:433; Interrogation_Position=2521;
> Antisense;
> GTTCACCCTGTCTACTATCAAGACA
>>probe:MOE430A:1415670_at:254:643; Interrogation_Position=2533;
> Antisense;
> TACTATCAAGACACTCGAAGAGGCT
>>probe:MOE430A:1415670_at:54:269; Interrogation_Position=2556;
> Antisense;
> CTGTGGGCAATATTGTGAAGTTCCT
>>probe:MOE430A:1415670_at:405:339; Interrogation_Position=2583;
> Antisense;
> GAATGCATCCTTGTGAGAGGTCAGA
>>probe:MOE430A:1415670_at:60:395; Interrogation_Position=2597;
> Antisense;
> GAGAGGTCAGACAAAGTGCCAGAAA
>>probe:MOE430A:1415670_at:284:165; Interrogation_Position=2619;
> Antisense;
> AAAACAAGAACACCCACACGCTGCT
>>probe:MOE430A:1415670_at:622:145; Interrogation_Position=2634;
> Antisense;
> ACACGCTGCTGCTAGCTGGAGTATT
>>probe:MOE430A:1415670_at:291:661; Interrogation_Position=2804;
> Antisense;
> TATCTTGTCCAACACTACGTCGAAG
> let me know if I/we can help in any other way.
> best wishes,
> 			--b0b kuhn


-------------- next part --------------
An embedded and charset-unspecified text was scrubbed...
Name: MOE430_2.0_UCSC.txt
Url: http://www.soe.ucsc.edu/pipermail/genome/attachments/20070426/e93b6a0b/MOE430_2.0_UCSC-0001.txt