[Genome] Evofold seqs conserved up to mouse?

[Archana Thakkapallayil]

Hello Peter,

Unfortunately, there is no direct way to get this information from our 
Browser. However, you could do an intersection between the multiz17way 
table and the evofold table on hg17, using the Table Browser and then 
then write your own program to pull out the information that you are 
looking for from the output. The evofold track was originally created on 
hg17 and was lifted to hg16 and hg18. So I suggest you to do the 
intersection from hg17. To get to this, make the following selections in 
the Table browser:

clade: vertebrate
genome: human
assembly: May 2004
group: Comparative Genomics
track: Conservation
table: multiz17way
select "genome" radio button.
click on "intersection" create button
On this page select "group: Genes and Gene prediction Tracks"; "track: 
EvoFold"; "table: evofold" and then choose "Base-pair-wise intersection 
(AND) of Conservation and EvoFold" and hit "submit" button.
Back on the main page select output format "MAF-multiple alignment 
format" and click on "get output".

The resulting output is the maf format of all 17 species used in the 
Conservation track, that have an intersection with the evofold track. 
You may want to write your own program to pull out the sequences for 
human and mouse.

Also, please note that there are cases where the evofold item is split 
across two alignment blocks in the maf file. For example, the sequence 
of evofold item: evofold: Item: 2245011_0_+_102 (Position: 
chr7:127401559-127401610) on hg17 and mm7 are:

hg17.chr7   TGTGTTACTATTTCGGGCGAGCCAGTGTTTCCAGGGGAAACCTAATGACGCA
mm7         TGTGTTACTATTTCGGGCGAGCCAGTGTTTCCAGGGGAAACCTAATGACGCA

But, when you get the output from the Table browser, this is actually 
split into two parts as follows:
s hg17.chr7               127401558 33 + 158628139 
TGTGTTACTATTTCGGGCGAGCCAGTGTTTCCA
s mm7.chr6                 28913543 33 + 149646834 
TGTGTTACTATTTCGGGCGAGCCAGTGTTTCCA
=======================================
s hg17.chr7               127401591 19 + 158628139 GGGGAAACCTAATGACGCA
s mm7.chr6                 28913576 19 + 149646834 GGGGAAACCTAATGACGCA

You can also get the details of the multiple species alignments and RNA 
secondary structure annotation by clicking on the individual evofold 
item from the browser.

I hope this information helps you. Please be sure to write back if you 
need further information.

Regards,

Archana
UCSC Genome Bioinformatics Group

 
Pete Shepard wrote:
> Dear UCSC Browser Folks,
>
> I would like to export a table of Evofold human sequences that are conserved
> in mouse. Can you tell me how to go about this?
>
> Thanks,
>
> Peter
> _______________________________________________
> Genome maillist  -  Genome at soe.ucsc.edu
> http://www.soe.ucsc.edu/mailman/listinfo/genome
>