[Genome] Blat finds NO match for genomic DNA

[Ulas Karaoz]

Hi,
I have the following observation, which is unexpected. I pull out the 
following human DNA using the browsers "Get DNA in a window" 
(range=chr17:34993079-34993128 in hg17-May2004) and then Blat the same 
sequence against the same version of the genome. Blat cannot find any 
match.

How is that possible? Am I doing anything wrong?

The sequence I am pulling out via 
"http://genome.ucsc.edu/cgi-bin/hgc?hgsid=79481900&o=34993078&g=getDna&i=mixed&c=chr17&l=34993078&r=34993148&db=hg17&hgsid=79481900"
is as follows:

>hg17_dna range=chr17:34993079-34993128 5'pad=0 3'pad=0 revComp=FALSE strand=? repeatMasking=none
ACCCCATCTCTACTAAAAATACAAAAATTAGCTGGGTGTGGTGGCCCATG




Best.
Ulas Karaoz.