[Genome] local gfClient / gfServer vs. web BLAT on short sequences

[Julien Lagarde]

Hi Genome,

I am a bit puzzled by the alignements i get with my local gfClient / 
gfServer compared to those given by the online UCSC blat server.

my input seq is:

 >chr22_primer
TTGCCTTCTCCCTCATCGAGGGTTA

Online BLAT result (hg17) is:


match    mis-     rep.     N's    Q gap    Q gap    T gap    T gap    
strand    Q            Q       Q        Q      T            T       T    
    T      block    blockSizes     qStarts     tStarts
         match    match           count    bases    count    bases    
          name         size    start    end    name         size    
start    end    count
---------------------------------------------------------------------------------------------------------------------------------------------------------------
25    0    0    0    0    0    0    0    -    chr22_primer    25    0    
25    chr22    49554710    29006841    29006866    1    25,    0,    
29006841,
21    1    0    0    0    0    0    0    +    chr22_primer    25    3    
25    chr7    158628139    73878910    73878932    1    22,    3,    
73878910,


local gfClient/gfServer (v.32) output is:


11    0    0    0    0    0    0    0    +    chr22_primer    25    0    
11    chr1    245522847    7292025    7292036    1    11,    0,    7292025,
11    0    0    0    0    0    0    0    +    chr22_primer    25    0    
11    chr1    245522847    14727360    14727371    1    11,    0,    
14727360,
11    0    0    0    0    0    0    0    +    chr22_primer    25    0    
11    chr1    245522847    17882525    17882536    1    11,    0,    
17882525,
11    0    0    0    0    0    0    0    +    chr22_primer    25    0    
11    chr1    245522847    18867990    18868001    1    11,    0,    
18867990,
11    0    0    0    0    0    0    0    +    chr22_primer    25    0    
11    chr1    245522847    19615590    19615601    1    11,    0,    
19615590,
11    0    0    0    0    0    0    0    +    chr22_primer    25    0    
11    chr1    245522847    24596870    24596881    1    11,    0,    
24596870,
12    0    0    0    0    0    0    0    +    chr22_primer    25    0    
12    chr1    245522847    26453344    26453356    1    12,    0,    
26453344,
15    0    0    0    0    0    0    0    +    chr22_primer    25    0    
15    chr12    132449811    88185840    88185855    1    15,    0,    
88185840,
15    0    0    0    0    0    0    0    +    chr22_primer    25    0    
15    chr12    132449811    131134400    131134415    1    15,    0,    
131134400,
14    0    0    0    0    0    0    0    -    chr22_primer    25    2    
16    chr1    245522847    10657190    10657204    1    14,    9,    
10657190,
13    0    0    0    0    0    0    0    -    chr22_primer    25    2    
15    chr1    245522847    19442182    19442195    1    13,    10,    
19442182,
12    0    0    0    0    0    0    0    -    chr22_primer    25    3    
15    chr1    245522847    22864170    22864182    1    12,    10,    
22864170,
15    0    0    0    0    0    0    0    -    chr22_primer    25    0    
15    chr11    134452384    73282830    73282845    1    15,    10,    
73282830,
15    0    0    0    0    0    0    0    -    chr22_primer    25    0    
15    chr2    243018229    60887140    60887155    1    15,    10,    
60887140,
25    0    0    0    0    0    0    0    -    chr22_primer    25    0    
25    chr22    49554710    29006841    29006866    1    25,    0,    
29006841,
15    0    0    0    0    0    0    0    -    chr22_primer    25    1    
16    chr4    191411218    48118575    48118590    1    15,    9,    
48118575,
16    0    0    0    0    0    0    0    -    chr22_primer    25    1    
17    chr7    158628139    4776264    4776280    1    16,    8,    4776264,


The parameters i use on my local installation are:

# convert hg17 to 2bit, no mask:
$ faToTwoBit -noMask 
/seq/genomes/H.sapiens/golden_path_200405/chromFa/*fa 
complete_hg17_noMask.2bit

# start gfServer:
$ gfServer -tileSize=10 -stepSize=5 -canStop start localhost 3500 
complete_hg17_noMask.2bit

# query with gfClient:
$ gfClient -minScore=0 -nohead -minIdentity=0 localhost 3500 / 
chr22_primer.fa chr22_primer.psl

I'm trying to make my local blat as sensitive as possible for short 
seqs, following the recommendations posted by you guys in this list.
This results in many spurious hits, as expected. No problem, I can deal 
with this, but the thing that bothers me is that my blat skips an 
obvious, near-perfect match on chr7
(qStart=73878910)
that the online blat finds.

Do you have any idea why?
Thanks in advance,
j.

-- 
-----------------------------------------------------
Julien Lagarde
Genome Bioinformatics Research Group
Centre de Regulacio Genomica 
Grup de Recerca en Informatica Biomedica (IMIM)
Dr. Aiguader, 88 				(+34) 93 3160166 ph
E-08003 Barcelona				(+34) 93 3160099 fax
http://genome.imim.es
--------------------------------