[Genome] chromosome 6 differences?
Rachel Harte
hartera at soe.ucsc.edu
Tue Dec 19 09:38:45 PST 2006
Dear Fonnet Bleeker,
chr6_cox_hap1 and chr6_qbl_hap2 are haplotypes of chr6. Therefore they
will have some regions that are different to the reference chr6 and some
that are identical. The region that you found with the PCR tool is a
region that is identical between chr6 and the two haplotypes.
You can find more information on haplotypes by searching using Google or
in Wikipedia (http://www.wikipedia.org/).
I hope that this helps you. Please let us know if you have further
questions.
Rachel
Rachel Harte
UCSC Genome Bioinformatics Group
http://genome.ucsc.edu
On Tue, 19 Dec 2006, F.E. Bleeker wrote:
> Dear Mr/Mrs,
>
> By using the in-silico PCR feature of yours (FOR
> GAGCTTCACTTTCTCTGCCTGTA and REV AAGAGAATGGGAAAGGGATACAA for DDR1
> human), I got back 3 amplicons at three different chromosomal parts:
> chr6:30,970,105-30,970,502
> chr6_cox_hap1:2,310,733-2,311,130
> chr6_qbl_hap2:2,109,062-2,109,459
> They are containing exactly the same amplicon of 398 bp. I have been
> trying to find on your website, Ensembl and Google what the
> chr6_cox_hap1 could be, but I have not been able to find anymore
> information about the meaning of this.
>
> Therefore I am wondering whether you could tell me the differences
> between these chromosomes? Are they duplications of chromosome 6?
>
> Please find attached anymore information if necessary with the
> hyperlinks for the different chromosomal regions.
>
> Thanking you for your help in advance,
> Yours Sincerely,
> Fonnet Bleeker
>
> *********************************
> Fonnet Bleeker, MD, PhD student
> Department of Neurosurgery
> Academic Medical Centre
>
> Temporary address:
> Oncogenomics Center, Genetic Unit
> Institute for Cancer Research and Treatment (IRCC)
> Strada Provinciale 142 km 3,95
> 10060 Candiolo,Torino-Italy
> tel +390119933223
> fax +390119933225
>
> e-mail: f.e.bleeker at amc.uva.nl
>
>
>
More information about the Genome
mailing list