From yeserin at gmail.com Mon Mar 3 06:25:49 2008 From: yeserin at gmail.com (Yeserin YILDIRIM) Date: Mon, 3 Mar 2008 16:25:49 +0200 Subject: [Genome-mirror] help about primer design Message-ID: Dear Madam/Sir I am trying to design primers for a gene.When I run my primers in your electronic pcr program, the program gives me two region one of which is termed as random. The other region is my desired one.(The result is pasted below.) What does "random" mean? Should I use this primer set or would it lead to trouble?Could you inform me? Sincerely, Yeserin Yildirim Bogazici University, Department of Molecular Biology and Genetics Istanbul/Turkey chr17_random:2362330+2362803 474bp CACTCACGTCATCATCCCCT GCTTCCCCACACTCAAGTTC CACTCACGTCATCATCCCCTgccccatcctggccaccgctctccanggaa tttcttaaaaccatccagcgtgcgttccccgttgtaatcaatgacctgtg gaagacagggatgagtgcagggngctggtcccggcccagagccaatctcc tggcattggctcctcctccctagagaaaggcagagcaggcccggtccgng tggctcacacccggaatccagcacatntngggagttcaaaaacagcctag gcaatatagtgagatcccatctctctcgaaaaacaaaggtgggtgcttct gaaggagctcccacagctcttctccncacctgactagccccaggctcctt ccagagaggcacccaggctggcgtggggaccactgctcttcccagagccc gccccagccccgtctggagggaaggcgcaccgtcctgtcggcactggcag gaaaGAACTTGAGTGTGGGGAAGC chr17:77396302+77396769 468bp CACTCACGTCATCATCCCCT GCTTCCCCACACTCAAGTTC CACTCACGTCATCATCCCCTgccccatcctggccaccgctctccaggaat ttcttaaaaccatccagcgtgcgttccccgttgtaatcaatgacctgtgg aagacagggatgagtgcaggggctggtcccggcccagagccaatctcctg gcattggctcctcctccctagagaaaggcagagcaggcccggtccggtgg ctcacacccggaatccagcacattgggagttcaaaaacagcctaggcaat atagtgagatcccatctctctcgaaaaacaaaggtgggtgcttctgaagg agctcccacagctcttctcccacctgactagccccaggctccttccagag aggcacccaggctggcgtggggaccactgctcttcccagagcccgcccca gccccgtctggagggaaggcgcaccgtcctgtcggcactggcaggaaaGA ACTTGAGTGTGGGGAAGC From kayla at soe.ucsc.edu Mon Mar 3 10:20:15 2008 From: kayla at soe.ucsc.edu (Kayla Smith) Date: Mon, 3 Mar 2008 10:20:15 -0800 (PST) Subject: [Genome-mirror] help about primer design In-Reply-To: References: Message-ID: Hello Yeserin, Here is a link to our FAQ on the chrN_random: http://genome.ucsc.edu/FAQ/FAQdownloads#download10 I hope this information is helpful to you. Please don't hesitate to contact us again if you require further assistance. Kayla Smith UCSC Genome Bioinformatics Group On Mon, 3 Mar 2008, Yeserin YILDIRIM wrote: > Dear Madam/Sir > I am trying to design primers for a gene.When I run my primers in your > electronic pcr program, the program gives me two region one of which is > termed as random. The other region is my desired one.(The result is pasted > below.) What does "random" mean? Should I use this primer set or would it > lead to trouble?Could you inform me? > > Sincerely, > > Yeserin Yildirim > Bogazici University, Department of Molecular Biology and Genetics > Istanbul/Turkey > > > chr17_random:2362330+2362803 474bp CACTCACGTCATCATCCCCT > GCTTCCCCACACTCAAGTTC > CACTCACGTCATCATCCCCTgccccatcctggccaccgctctccanggaa > tttcttaaaaccatccagcgtgcgttccccgttgtaatcaatgacctgtg > gaagacagggatgagtgcagggngctggtcccggcccagagccaatctcc > tggcattggctcctcctccctagagaaaggcagagcaggcccggtccgng > tggctcacacccggaatccagcacatntngggagttcaaaaacagcctag > gcaatatagtgagatcccatctctctcgaaaaacaaaggtgggtgcttct > gaaggagctcccacagctcttctccncacctgactagccccaggctcctt > ccagagaggcacccaggctggcgtggggaccactgctcttcccagagccc > gccccagccccgtctggagggaaggcgcaccgtcctgtcggcactggcag > gaaaGAACTTGAGTGTGGGGAAGC > > chr17:77396302+77396769 468bp CACTCACGTCATCATCCCCT > GCTTCCCCACACTCAAGTTC > CACTCACGTCATCATCCCCTgccccatcctggccaccgctctccaggaat > ttcttaaaaccatccagcgtgcgttccccgttgtaatcaatgacctgtgg > aagacagggatgagtgcaggggctggtcccggcccagagccaatctcctg > gcattggctcctcctccctagagaaaggcagagcaggcccggtccggtgg > ctcacacccggaatccagcacattgggagttcaaaaacagcctaggcaat > atagtgagatcccatctctctcgaaaaacaaaggtgggtgcttctgaagg > agctcccacagctcttctcccacctgactagccccaggctccttccagag > aggcacccaggctggcgtggggaccactgctcttcccagagcccgcccca > gccccgtctggagggaaggcgcaccgtcctgtcggcactggcaggaaaGA > ACTTGAGTGTGGGGAAGC > _______________________________________________ > Genome-mirror mailing list > Genome-mirror at soe.ucsc.edu > http://www.soe.ucsc.edu/mailman/listinfo/genome-mirror > From kayla at soe.ucsc.edu Wed Mar 5 11:01:03 2008 From: kayla at soe.ucsc.edu (Kayla Smith) Date: Wed, 05 Mar 2008 11:01:03 -0800 Subject: [Genome-mirror] notice of release of ponAbe2 data Message-ID: <47CEEDEF.4040408@cse.ucsc.edu> Mirror Email Hello mirror sites, This message is to announce that we are preparing to release the new Orangutan assembly, ponAbe2, soon. Mirror sites should be prepared to host: ~30 Gb ( ponAbe2 tables ) ~29 Gb ( files in /gbdb/ponAbe2/* ) Additionally, there are Orangutan net and chain tables (called netPonAbe2 and *chainPonAbe2*) from other organisms that will be released to their respective annotation databases. The sizes of these tables are as follows: hg18 5.4 G mm9 2.7 G ornAna1 1.3 G monDom4 7.3 G panTro2 6.0 G rheMac2 3.3 G ================= total 26.0 G tables in other assemblies Grand total: ~55 G of new data. Please let us know if you have any questions or concerns. Thanks, Kayla UCSC Genome Bioinformatics Group From hiram at soe.ucsc.edu Thu Mar 6 06:19:38 2008 From: hiram at soe.ucsc.edu (Hiram Clawson) Date: Thu, 06 Mar 2008 06:19:38 -0800 Subject: [Genome-mirror] rsync updated at hgdownload Message-ID: <47CFFD7A.80607@soe.ucsc.edu> Good Morning Mirror Fans: Please note, our version of rsync was updated to version 3.0 this morning. You shouldn't notice any difference in behavior. The upgrade may help with some occasional problems that have been reported. Please let us know if you experience any new difficulties. --Hiram From kuhn at soe.ucsc.edu Thu Mar 6 10:07:02 2008 From: kuhn at soe.ucsc.edu (Robert Kuhn) Date: Thu, 6 Mar 2008 10:07:02 -0800 Subject: [Genome-mirror] recently dropped some tables Message-ID: <200803061807.KAA00128@moondance.cse.ucsc.edu> dear mirrors, we recently dropped the xenoExt tables from all assemblies other than human. This means that we've removed the tables from mm5, mm6, panTro1 and rn3 and will no longer be supporting them. If you are not automatically removing dropped tables, you can reclaim 41 Gb of space by dropping these tables. thanks, --b0b kuhn ucsc genome bioinformatics group From zhai at salk.edu Thu Mar 6 11:03:58 2008 From: zhai at salk.edu (Yufeng Zhai) Date: Thu, 6 Mar 2008 11:03:58 -0800 Subject: [Genome-mirror] Display sequence links on blat result page Message-ID: <69308BB9-3B54-4D8F-AB1F-EA37A36870FB@salk.edu> Dear Sir or Madam I have installed genome browser on my local computer for some in house genome research, everything going pretty well. One more question I want to ask is about the sequence retrieval features for custom track. I have added some rna tracks to the database, and browser can display them correctly after blat. However, when I click one of the sequence names of those custom track, they only show me blat result for this sequence, not like I found on your server that have links to retrieve sequences (For example: I use a sequence to blat against S.cerevisiae, then on the graphical page, it also shows some ESTs at the hit position, if I click the name of one est, it will display information of this EST, and at the top section of this information, it has a link says like 'EST sequence: DBxxxxxxx', when I click this link, it will display this est's sequence) My question is: How to add this kind of sequence retrieval featurein the page after I click the sequence names in the browser, in what table are those sequences information stored, are there any manual about adding this feature? Thank you very much. Yufeng From kuhn at soe.ucsc.edu Thu Mar 6 16:20:12 2008 From: kuhn at soe.ucsc.edu (Robert Kuhn) Date: Thu, 6 Mar 2008 16:20:12 -0800 Subject: [Genome-mirror] more dropped files Message-ID: <200803070020.QAA27168@moondance.cse.ucsc.edu> greetings, mirrors, In conjunction with the dropped tables I mentioned in a recent message, we are also dropping the following zipped files (7.6 Gb): http://hgdownload.cse.ucsc.edu/goldenPath/panTro1/database/ [ ] xenoEst.sql 27-Feb-2008 06:05 2.2K [ ] xenoEst.txt.gz 27-Feb-2008 06:35 2.1G http://hgdownload.cse.ucsc.edu/goldenPath/rnJun2003/database/ [ ] xenoEst.sql 27-Feb-2008 07:35 2.2K [ ] xenoEst.txt.gz 27-Feb-2008 08:02 2.0G http://hgdownload.cse.ucsc.edu/goldenPath/mm6/database/ [ ] xenoEst.sql 27-Feb-2008 02:28 2.2K [ ] xenoEst.txt.gz 27-Feb-2008 02:57 1.7G http://hgdownload.cse.ucsc.edu/goldenPath/mm5/database/ [ ] xenoEst.sql 26-Feb-2008 19:18 2.2K [ ] xenoEst.txt.gz 26-Feb-2008 20:40 1.8G thanks, --b0b kuhn ucsc genome bioinformatics group From angie at soe.ucsc.edu Fri Mar 7 10:06:30 2008 From: angie at soe.ucsc.edu (Angie Hinrichs) Date: Fri, 7 Mar 2008 10:06:30 -0800 (PST) Subject: [Genome-mirror] [Genome] uncertain annotations in UCSC In-Reply-To: References: Message-ID: Hi Na, UCSC does not assign the names; we simply run RepeatMasker on the genome and display its results. RepeatMasker works by aligning consensus sequences from a library file to the genome. The library file is the source of the repeat name, class and family annotated by RepeatMasker. The library file is owned by RepBase Update (GIRI), but can be viewed after completing a registration process. To retrieve the library file, visit this web page: http://www.girinst.org/repbase/index.html On the left there is a "Free registration" link. After you have completed the registration process, the information in RepBase Update and/or RepBase Reports may be helpful. Best wishes for your research, Angie On Fri, 7 Mar 2008, Na Liu wrote: > Dear professors, > > I want to obtain all FB elements information of Drosophila > melanogaster from UCSC. I am not sure if my extracting way is > correct because the results are suspectable: > > firstly , I choose 'Variation and Repeats ' in the group box by > using TableBrowser. Below, at the output format box, I choose "all > fields from selected table". > > Then I obtained a long list. I notice there are some entries > annotated as FB4_DM. Are they meant FB elements? Why do you name them > FB4, not FB? What do you mean by the number '4'? They are > suspectable because some of them are very short (may be ~30nt, 40nt, > 50nt,....)and can not form a hairpin structure(according to the > definition, FB element has long inverted terminal repeats). > > If my extracting method is not correct, could you please tell me the > correct one? > > Look forward to your reply > sincerely .!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! > Look forward to your reply > sincerely .!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! > Look forward to your reply > sincerely .!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! > > Best > Na > > > > ===================================================================== > > Please note that this e-mail and any files transmitted with it may be > privileged, confidential, and protected from disclosure under > applicable law. If the reader of this message is not the intended > recipient, or an employee or agent responsible for delivering this > message to the intended recipient, you are hereby notified that any > reading, dissemination, distribution, copying, or other use of this > communication or any of its attachments is strictly prohibited. If > you have received this communication in error, please notify the > sender immediately by replying to this message and deleting this > message, any attachments, and all copies and backups from your > computer. > > _______________________________________________ > Genome maillist - Genome at soe.ucsc.edu > http://www.soe.ucsc.edu/mailman/listinfo/genome From angie at soe.ucsc.edu Fri Mar 7 11:21:56 2008 From: angie at soe.ucsc.edu (Angie Hinrichs) Date: Fri, 7 Mar 2008 11:21:56 -0800 (PST) Subject: [Genome-mirror] [Genome] uncertain annotations in UCSC In-Reply-To: <4D73B3FC-BFD3-4E30-8D3B-59AE7C928D54@mskcc.org> References: <4D73B3FC-BFD3-4E30-8D3B-59AE7C928D54@mskcc.org> Message-ID: Hi Na, The single FB4_DM in the library file is the consensus repeat sequence. RepeatMasker aligns it to the genome using a sensitive alignment tool called cross_match, and indeed the sequence aligns to hundreds of places in the genome -- that is why it is considered a repetitive sequence. For details about how RepeatMasker annotates repeats on the genome using those consensus sequences, the best people to answer your questions are the authors of RepeatMasker (see www.repeatmasker.org). For details about how the consensus sequences are generated, the GIRI scientists are probably the most knowledgeable. Hope that helps, and hope you have a good weekend too, Angie On Fri, 7 Mar 2008, Na Liu wrote: > Hi, Angie, > > I logged in Giri. I obtain such a file : repeatmaskerlibraries-20071204.tar.gz > > the procedure for obtaining it is: > 1. I click the link : http://www.girinst.org/repbase/update/index.html > 2. at the bottom of this page, I noticed the Drosophila. Then I click the > drorep.ref. Then I downloaded the above file > (repeatmaskerlibraries-20071204.tar.gz) > 3. When I search 'FB4' in the file, I found there was only one FB4_DM. How do > you get the results listed in UCSC? (According to my calculation, there are > totally 389 entries annotated as FB4_DM. How did you get the 389 entries? What > criteria did you use to annotate is as FB4_DM? ) > > > Look forward to your reply and Have a good weekend. > > Na > > > On Mar 7, 2008, at 1:06 PM, Angie Hinrichs wrote: > > > Hi Na, > > > > UCSC does not assign the names; we simply run RepeatMasker on the > > genome and display its results. RepeatMasker works by aligning > > consensus sequences from a library file to the genome. The library > > file is the source of the repeat name, class and family annotated by > > RepeatMasker. The library file is owned by RepBase Update (GIRI), but > > can be viewed after completing a registration process. To retrieve > > the library file, visit this web page: > > > > http://www.girinst.org/repbase/index.html > > > > On the left there is a "Free registration" link. After you have > > completed the registration process, the information in RepBase Update > > and/or RepBase Reports may be helpful. > > > > Best wishes for your research, > > Angie > > > > > > On Fri, 7 Mar 2008, Na Liu wrote: > > > > > Dear professors, > > > > > > I want to obtain all FB elements information of Drosophila > > > melanogaster from UCSC. I am not sure if my extracting way is > > > correct because the results are suspectable: > > > > > > firstly , I choose 'Variation and Repeats ' in the group box by > > > using TableBrowser. Below, at the output format box, I choose "all > > > fields from selected table". > > > > > > Then I obtained a long list. I notice there are some entries > > > annotated as FB4_DM. Are they meant FB elements? Why do you name them > > > FB4, not FB? What do you mean by the number '4'? They are > > > suspectable because some of them are very short (may be ~30nt, 40nt, > > > 50nt,....)and can not form a hairpin structure(according to the > > > definition, FB element has long inverted terminal repeats). > > > > > > If my extracting method is not correct, could you please tell me the > > > correct one? > > > > > > Look forward to your reply > > > sincerely .!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! > > > Look forward to your reply > > > sincerely .!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! > > > Look forward to your reply > > > sincerely .!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! > > > > > > Best > > > Na > > > > > > > > > > > > ===================================================================== > > > > > > Please note that this e-mail and any files transmitted with it may be > > > privileged, confidential, and protected from disclosure under > > > applicable law. If the reader of this message is not the intended > > > recipient, or an employee or agent responsible for delivering this > > > message to the intended recipient, you are hereby notified that any > > > reading, dissemination, distribution, copying, or other use of this > > > communication or any of its attachments is strictly prohibited. If > > > you have received this communication in error, please notify the > > > sender immediately by replying to this message and deleting this > > > message, any attachments, and all copies and backups from your > > > computer. > > > > > > _______________________________________________ > > > Genome maillist - Genome at soe.ucsc.edu > > > http://www.soe.ucsc.edu/mailman/listinfo/genome > > > -- angie at soe.ucsc.edu Software Developer, UCSC CBSE / Genome Bioinformatics Group From rhead at soe.ucsc.edu Tue Mar 11 16:04:23 2008 From: rhead at soe.ucsc.edu (Brooke Rhead) Date: Tue, 11 Mar 2008 16:04:23 -0700 Subject: [Genome-mirror] localhost not maintaining configuration changes Message-ID: <47D70FF7.70401@soe.ucsc.edu> Hello Royden, It's good to hear that you are happy with the Genome Browser. We were unable to reproduce the problem here. We tried on a local mirror test server, using both its machine name and as "localhost", and without changing anything, our cart settings are being saved either way. You could check your cgi-bin/hg.conf file for cookie or central related issues. You might also want to check your apache error logs for clues when you see the problem using localhost. We recently saw this behavior here when we inadvertently got two conflicting cookies and two "hguid"s assigned. (You can see the hguids by doing a cart dump -- enter the word 'cartDump' after /cgi-bin/ in the url, for instance: http://genome.ucsc.edu/cgi-bin/cartDump . Scroll to the bottom of the page and look for "hguid=someNumber".) The solution was to delete one of the cookies. I hope this helps you narrow down the problem. If you have further questions, please feel free to contact us again at the genome-mirror mailing list address. -- Brooke Rhead UCSC Genome Bioinformatics Group ---------------------------------------------------------------- Subject: localhost not maintaining configuration changes From: Royden Clark Date: Tue, 11 Mar 2008 17:42:49 -0400 To: genome-mirror at soe.ucsc.edu Greetings all. It has been several years since I have worked with this browser and I am glad to in a position to be using it again. Installing our local mirror went well but I ran into one catch. When the user uses the browser remotely everything is fine but when it is used locally (localhost) any changes made via 'configure' or via changing image width apply once but when you move to the next set of positions via >> or >>> it returns to default settings. (using hgTracks) Again this only occurs when viewing it locally on the machine. Any suggestions on where to look in fixing this? Royden Clark. From ann at soe.ucsc.edu Thu Mar 13 13:49:24 2008 From: ann at soe.ucsc.edu (Ann Zweig) Date: Thu, 13 Mar 2008 13:49:24 -0700 Subject: [Genome-mirror] flood of data about to be released: consider your rsync Message-ID: <47D99354.9040200@soe.ucsc.edu> Hello Mirror Sites, As a result of the pipeline modification of our genBank update process, over the next few days, we will be replacing several tables in every database assembly. All of the genBank-related tables, to be exact. Please understand that most of the tables are simply being replaced, so there will not be much *net* *change* in the volume of data. However, depending on how you do your rsync, you may see new tables and be inclined to automatically download them all. I suggest that you consider dropping the old tables and adding the new ones (rather than rsync'ing). Or at least editing your rsync script to include the --whole-files parameter. The size of all of the genbank tables in the hg18 database alone is about 35GB. And as I mentioned, we will be replacing genBank tables for all 71 databases. If you have questions, please reply to this list so that we can all benefit from the discussion. Regards, ---------- Ann Zweig UCSC Genome Bioinformatics Group http://genome.ucsc.edu From davide.cittaro at ifom-ieo-campus.it Thu Mar 13 16:35:53 2008 From: davide.cittaro at ifom-ieo-campus.it (Davide Cittaro) Date: Fri, 14 Mar 2008 00:35:53 +0100 Subject: [Genome-mirror] flood of data about to be released: consider your rsync In-Reply-To: <47D99354.9040200@soe.ucsc.edu> References: <47D99354.9040200@soe.ucsc.edu> Message-ID: <4CF8114A-F6A2-4265-994A-068CB001BFD8@ifom-ieo-campus.it> On Mar 13, 2008, at 9:49 PM, Ann Zweig wrote: > Or at least editing your rsync script to include > the --whole-files parameter. Actually the correct option is "--whole-file" (or -W, better) ;-) d Davide Cittaro davide.cittaro at ifom-ieo-campus.it -- Give a man a fish, and he eats for a day. Teach a man to phish, and if he gets caught he'll be eating that fish through a straw From Janet_Yang at dfci.harvard.edu Mon Mar 17 11:26:06 2008 From: Janet_Yang at dfci.harvard.edu (Yang, Janet Q.) Date: Mon, 17 Mar 2008 14:26:06 -0400 Subject: [Genome-mirror] How do I find out Genome Browser Message-ID: Dear Genome Browser staff, I have down loaded mirror site whole Genome Browser on our server couple months again. Since that we found that your real site has more data. How do I found what version of Genome Browse I have down loaded from your mirror Genome Browser? Can you tell me where can I find the version of Genome Browser so I can compare my down load version of Genome Browser with your real site Genome Browser, and update my server side Genome Browse(mirror down load) as often as I need to. Please let me know. Thank you very much, Janet Yang Dana farber Cancer Institute. Boston, Ma 02115 617-632-4283 (office phone) The information transmitted in this electronic communication is intended only for the person or entity to whom it is addressed and may contain confidential and/or privileged material. Any review, retransmission, dissemination or other use of or taking of any action in reliance upon this information by persons or entities other than the intended recipient is prohibited. If you received this information in error, please contact the Compliance HelpLine at 800-856-1983 and properly dispose of this information. From ann at soe.ucsc.edu Mon Mar 17 13:46:39 2008 From: ann at soe.ucsc.edu (Ann Zweig) Date: Mon, 17 Mar 2008 13:46:39 -0700 Subject: [Genome-mirror] 230 GB of data coming this week Message-ID: <47DED8AF.7020106@soe.ucsc.edu> Hello mirror sites, Last week I wrote to let you know that we were going to be releasing a large amount of data this week (see email entitled "flood of data about to be released: consider your rsync"). I suggest that you consider rsyncing every night this week, so that you pick up a bit of new data at a time (about 30 GB per night). If you decide to wait an do an rsync after all the data is available, you might run into serious bandwidth problems trying to pick up over 230 GB of new data. Additionally, I recommend that you run your rsync this week with the -W (--whole-file) flag. Here is the schedule of data release for the week with database name followed by approximate size of changed tables. Already released during the weekend (or late last week): hg18 34684.3 MB danRer2 2628.1 MB danRer3 2578.25 MB danRer4 2567.74 MB danRer5 2120 MB dm1 1285.39 MB dm2 1312.95 MB dm3 1318.4 MB dp2 1143.2 MB dp3 1105.47 MB droAna1 1085.81 MB droAna2 1090.54 MB droEre1 1086.3 MB droGri1 1094.22 MB droMoj1 1092.98 MB droMoj2 1087.96 MB droSec1 1070.04 MB droSim1 1118.18 MB droPer1 1072.14 MB droVir1 1115.74 MB droVir2 1109.59 MB droYak1 1102.14 MB droYak2 1089.24 MB ================== TOTAL 63.44 GB Monday, March 17: mm6 5565.12 MB rn4 2153.94 MB sacCer1 38.48 MB strPur1 1141.02 MB strPur2 1199.35 MB tetNig1 1136.85 MB xenTro1 1181.54 MB xenTro2 1118.93 MB mm9 5707.34 MB anoCar1 1218.16 MB anoGam1 974.29 MB apiMel1 818.29 MB apiMel2 824.15 MB caePb1 1031.09 MB caeRem2 1022.46 MB cb1 307.02 MB cb3 988.86 MB ce2 465.52 MB ce4 1251.06 MB ci1 1680.12 MB ci2 1685.86 MB fr1 1167 MB fr2 1059.58 MB ================== TOTAL 32.95 GB Tuesday, March 18 hg17 36094.8 MB ================== TOTAL 35.25 GB Wednesday, March 19 bosTau1 1754.39 MB bosTau2 1683.25 MB bosTau3 2119.7 MB canFam1 1602.81 MB canFam2 1605.21 MB equCab1 928.95 MB felCat3 1355.39 MB galGal2 1868.75 MB galGal3 1797.08 MB gasAcu1 1178.19 MB mm5 5898.51 MB oryLat1 1518.45 MB mm8 5913.88 MB monDom1 940.31 MB monDom4 1256.01 MB ornAna1 847.43 MB ================== TOTAL 31.51 GB Thursday, March 20 hg16 34388.2 MB ================== TOTAL 33.58 GB Friday, March 21 mm7 6228.88 MB ponAbe2 1286.97 MB priPac1 1014.29 MB rheMac2 1381.8 MB rn3 2121.66 MB panTro1 9471.23 MB panTro2 9471.57 MB ================== TOTAL 30.25 GB As I mentioned in my previous post to the list, we replaced all genBank-related tables for all 71 databases. If you have any questions or concerns, please reply to the entire list so that we can all benefit from the discussion. Regards, ---------- Ann Zweig UCSC Genome Bioinformatics Group http://genome.ucsc.edu From rhead at soe.ucsc.edu Mon Mar 17 21:44:02 2008 From: rhead at soe.ucsc.edu (Brooke Rhead) Date: Mon, 17 Mar 2008 21:44:02 -0700 Subject: [Genome-mirror] How do I find out Genome Browser In-Reply-To: References: Message-ID: <47DF4892.6010308@soe.ucsc.edu> Hello Janet, One way to discover the version of CGIs that are being used on your mirror site (assuming it is up and running) is to go to the hgTracks CGI (i.e., http://yoursite.edu/cgi-bin/hgTracks) and look at the information displayed in the top bar of your web browser. It should include text that looks something like: "UCSC Genome Browser v177". We release a new version of the Genome Browser source code every two weeks. It is available as a zipped package here: http://hgdownload.cse.ucsc.edu/admin/ , or via CVS (instructions here: http://genome.ucsc.edu/admin/cvs.html). We announce the two-week releases and make other important announcements for mirrors on this mailing list (genome-mirror at soe.ucsc.edu), so you may want to subscribe to the list: http://www.soe.ucsc.edu/mailman/listinfo/genome-mirror . Tracks, tables, and assemblies are released anytime -- they are not tied to the source code release schedule. To see the history of these releases, see: http://genome.ucsc.edu/goldenPath/releaseLog.html . You might be interested in some of our other mirror sites' scripts for keeping mirror sites up to date (especially if you are only mirroring a portion of the available assemblies). These are available on the genomewiki, here: http://genomewiki.ucsc.edu/index.php/Browser_Mirrors . This genomewiki page might also be helpful: http://genomewiki.ucsc.edu/index.php/Category:Mirror_Site_FAQ . Finally, if you are planning to update table data for your mirror site, please see these important notices about the large amount of data being updated on our site and released this week: https://www.soe.ucsc.edu/pipermail/genome-mirror/2008-March/000756.html https://www.soe.ucsc.edu/pipermail/genome-mirror/2008-March/000759.html -- Brooke Rhead UCSC Genome Browser Bioinformatics Group Yang, Janet Q. wrote: > Dear Genome Browser staff, > > > > I have down loaded mirror site whole Genome Browser on our server couple months > again. Since that we found that your real site has more data. > > > > How do I found what version of Genome Browse I have down loaded from your mirror > Genome Browser? Can you tell me where can I find the version of Genome Browser > so I can compare my down load version of Genome Browser with your real site > Genome Browser, and update my server side Genome Browse(mirror down load) as > often as I need to. > > > > Please let me know. > > > > Thank you very much, > > > > Janet Yang > > Dana farber Cancer Institute. > > Boston, Ma 02115 > > 617-632-4283 (office phone) > > > The information transmitted in this electronic communication is intended only > for the person or entity to whom it is addressed and may contain confidential > and/or privileged material. Any review, retransmission, dissemination or other > use of or taking of any action in reliance upon this information by persons or > entities other than the intended recipient is prohibited. If you received this > information in error, please contact the Compliance HelpLine at 800-856-1983 and > properly dispose of this information. > > > _______________________________________________ > Genome-mirror mailing list > Genome-mirror at soe.ucsc.edu > http://www.soe.ucsc.edu/mailman/listinfo/genome-mirror From avpoliakov at lbl.gov Wed Mar 19 12:17:22 2008 From: avpoliakov at lbl.gov (Alexander Poliakov) Date: Wed, 19 Mar 2008 12:17:22 -0700 Subject: [Genome-mirror] ESTs track Message-ID: <47E166C2.3080905@lbl.gov> Hello, I am having problems with the ESTs track for a custom genome. I used "hgLoadPsl" to load the data from a psl file, and then I added the track information to the "trackDb" table. The browser displays the track in the dense mode, but when I switch to the full or pack mode, I get the following error: Can't start query: select direction from gbCdnaInfo where acc='E5AINME02JTJLR' mySQL error 1146: Table 'Ptricho.gbCdnaInfo' doesn't exist It looks like the browser needs some other tables (besides the "est" table) to work properly. Does anybody know where I can find a description of what else needs to be done in order to make this work? Thanks, -Alex From ann at soe.ucsc.edu Wed Mar 19 16:46:35 2008 From: ann at soe.ucsc.edu (Ann Zweig) Date: Wed, 19 Mar 2008 16:46:35 -0700 Subject: [Genome-mirror] ESTs track In-Reply-To: <47E166C2.3080905@lbl.gov> References: <47E166C2.3080905@lbl.gov> Message-ID: <47E1A5DB.3040105@soe.ucsc.edu> Hello Alex, The process that we use to create the EST tracks (along with several other related tracks) is quite complex and compute-intensive. You can look over the rough outline here: http://www.soe.ucsc.edu/~markd/genbank-update/ My suggestion to you would be to create psl tracks whose underlying tables are not named "est" or "all_est" or "*_est". Your track (table) would just be generic psl and would not be trying to look for the rest of the related tables. I hope this information is helpful to you. Please don't hesitate to contact the mail list again if you require further assistance. Regards, ---------- Ann Zweig UCSC Genome Bioinformatics Group http://genome.ucsc.edu Alexander Poliakov wrote: > Hello, > > I am having problems with the ESTs track for a custom genome. I used > "hgLoadPsl" to load the data from a psl file, and then I added the track > information to the "trackDb" table. The browser displays the track in > the dense mode, but when I switch to the full or pack mode, I get the > following error: > > Can't start query: select direction from gbCdnaInfo where > acc='E5AINME02JTJLR' > > mySQL error 1146: Table 'Ptricho.gbCdnaInfo' doesn't exist > > > It looks like the browser needs some other tables (besides the "est" > table) to work properly. Does anybody know where I can find a > description of what else needs to be done in order to make this work? > > Thanks, > -Alex > _______________________________________________ > Genome-mirror mailing list > Genome-mirror at soe.ucsc.edu > http://www.soe.ucsc.edu/mailman/listinfo/genome-mirror From avpoliakov at lbl.gov Wed Mar 19 16:52:26 2008 From: avpoliakov at lbl.gov (Alexander Poliakov) Date: Wed, 19 Mar 2008 16:52:26 -0700 Subject: [Genome-mirror] ESTs track In-Reply-To: <47E1A5DB.3040105@soe.ucsc.edu> References: <47E166C2.3080905@lbl.gov> <47E1A5DB.3040105@soe.ucsc.edu> Message-ID: <47E1A73A.2040706@lbl.gov> Thanks a lot, Ann! Regards, -Alex Ann Zweig wrote: > Hello Alex, > > The process that we use to create the EST tracks (along with several > other related tracks) is quite complex and compute-intensive. You can > look over the rough outline here: > http://www.soe.ucsc.edu/~markd/genbank-update/ > > My suggestion to you would be to create psl tracks whose underlying > tables are not named "est" or "all_est" or "*_est". Your track (table) > would just be generic psl and would not be trying to look for the rest > of the related tables. > > I hope this information is helpful to you. Please don't hesitate to > contact the mail list again if you require further assistance. > > Regards, > > ---------- > Ann Zweig > UCSC Genome Bioinformatics Group > http://genome.ucsc.edu > > > > Alexander Poliakov wrote: >> Hello, >> >> I am having problems with the ESTs track for a custom genome. I used >> "hgLoadPsl" to load the data from a psl file, and then I added the >> track information to the "trackDb" table. The browser displays the >> track in the dense mode, but when I switch to the full or pack mode, I >> get the following error: >> >> Can't start query: select direction from gbCdnaInfo where >> acc='E5AINME02JTJLR' >> >> mySQL error 1146: Table 'Ptricho.gbCdnaInfo' doesn't exist >> >> >> It looks like the browser needs some other tables (besides the "est" >> table) to work properly. Does anybody know where I can find a >> description of what else needs to be done in order to make this work? >> >> Thanks, >> -Alex >> _______________________________________________ >> Genome-mirror mailing list >> Genome-mirror at soe.ucsc.edu >> http://www.soe.ucsc.edu/mailman/listinfo/genome-mirror